Сардэчна запрашаем перевод: Error 404 (Not Found)!!1

Содержание

%d0%b4%d0%be%d0%b1%d1%80%d1%8b%d0%b9 на белорусский — Русский-Белорусский

Тон освещения вопроса был задан лично Вильгельмом II, который утверждал, что Британия пытается дестабилизировать власть османского султана, а также обвинил Британию в гибели 80 тысяч армян.

Тон асвятлення пытання быў зададзены асабіста Вільгельмам II, які сцвярджаў, што Брытанія спрабуе дэстабілізаваць уладу асманскага султана, а таксама звінаваціў Брытанію ў гібелі 80 тысяч армян.

WikiMatrix

Согласно трактату «Об управлении империей» императора Константина VII Багрянородного, хорватская армия в эпоху Томислава состояла из 100 тысяч пехоты и 60 000 кавалерии, а также располагала 80 большими и 100 малыми судами — иными словами: вооружённые силы Томислава превосходили своей мощью византийские.

Паводле трактата «Пра кіраванне імперыяй» імператара Канстанціна VII Парфірароднага, харвацкая армія ў эпоху Таміслава складалася з 100 тысяч пяхоты і 60 000 кавалерыі, а таксама мела 80 вялікіх і 100 малых суднаў — іншымі словамі: узброеныя сілы Таміслава пераўзыходзілі сваёй моцай візантыйскія.

WikiMatrix

Наиболее распространёнными местными языками являются яванский, сунданский, мадурский — соответственно, более 80 миллионов, 30 миллионов и 13 миллионов носителей.

Найбольш распаўсюджанымі мясцовымі мовамі з’яўляюцца яванская, сунданская, мадурская — адпаведна, больш за 80 мільёнаў, 30 мільёнаў і 13 мільёнаў носьбітаў.

WikiMatrix

Основан в 2003 г. OMX — оператор Nordic Exchange, контролирующей порядка 80 % рынка ценных бумаг Скандинавии и Прибалтики.

Заснаваны ў 2003 г. OMX — аператар Nordic Exchange, кантралюе парадку 80% рынку каштоўных папер Скандынавіі і Прыбалтыцы.

WikiMatrix

Станции имеют длину 80 метров и оснащены боковыми платформами шириной 5 метров.

Станцыі маюць даўжыню 80 метраў і абсталяваны бакавымі платформамі шырынёй 5 метраў.

WikiMatrix

Перевозка строительных материалов проходила 15—16 января 1911 года (на ней было занято 80 собак, работающих в упряжке по 10 через день), под крышу дом был подведён уже 21 января.

Перавозка будаўнічых матэрыялаў праходзіла 15—16 студзеня 1911 года (на ёй былі заняты 80 сабак, якія працавалі ў запрэжцы па 10 праз дзень), пад дах дом быў падведзены ўжо 21 студзеня.

WikiMatrix

6 января 1930 года пленум ЦК КП(б)Б принял решение коллективизировать 75-80 % крестьянских хозяйств.

6 студзеня 1930 года пленум ЦК КП(б)Б прыняў рашэнне калектывізаваць 75-80% сялянскіх гаспадарак.

WikiMatrix

По глубине очага различают нормальные (70—80 км), промежуточные (80—300 км) и глубокие землетрясения (более 300 км).

Па глыбіні ачага адрозніваюць нармальныя (70-80 км), прамежкавыя (80-300 км) і глыбокія землятрусу (больш за 300 км) .

WikiMatrix

К 2011 году её готовность составляла около 80 %, однако часть средств, предназначенных для её строительства, была переведена на строительство спортивно-оздоровительного центра.

Да 2011 годзе яе гатоўнасць складала каля 80 %, аднак частка сродкаў, прызначаных для яе будаўніцтва, была перакладзеная на будаўніцтва спартыўна-аздараўленчага цэнтра.

WikiMatrix

В летописях указывается численность 280 000 ратников, 80 900 обозных людей и 200 пушек, но эти данные сильно преувеличены.

У летапісах згадваецца колькасць 280 000 ратнікаў, 80 900 абозных людзей і 200 гармат, але звесткі гэтыя перабольшаны.

WikiMatrix

Конфликт между Макинтошем и Джойсом продолжился, на сей раз из-за необходимости использовать собак при закладке склада

80° ю. ш..

Канфлікт паміж Макінтошам і Джойсам прадоўжыўся, на гэты раз з-за неабходнасці выкарыстоўваць сабак пры закладцы склада 80° пд. ш..

WikiMatrix

Собрано более 80 000 экспонатов, которые хранятся в музеях Новосибирска, Бийска, в школьных музеях Чёрного Ануя и Солонешного.

Сабрана больш за 80 000 экспанатаў, якія захоўваюцца ў музеях Новасібірска, Бійска, у школьных музеях Чорнага Ануя і Саланешнага.

WikiMatrix

Де Ланда не знал, что письменность майя была не алфавитной, а логосиллабической, а помогавшие ему майя в некоторых случаях записывали не произношение испанских букв, а их название (например, be, hache, ka, cu).

Дэ Ланда не ведаў, што пісьменнасць мая была не алфавітная, а логасілабічная, а мая, якія дапамагалі яму, ў некаторых выпадках запісвалі не вымаўленне іспанскіх літар, а іх назвы (напрыклад, be, hache, ka, cu).

WikiMatrix

Вы на 80% велосипедист. »

Вы на 80% раварыст. «

QED

Немецкие субмарины потопили 80 португальских кораблей.

Нямецкія субмарыны патапілі 80 партугальскіх караблёў.

WikiMatrix

В Загребе они применяются наряду с более старыми типами T4 YU и B4 YU.

У Заграбе яны ўжываюцца нараўне з больш старымі тыпамі T4 YU і B4 YU.

WikiMatrix

Е́ллинг (Jelling) — населённый пункт в Дании на полуострове Ютландия (80 км от Орхуса и 10 км от Вейле).

Е́лінг (Jelling) — населены пункт у Даніі на паўвостраве Ютландыя (80 км ад Орхуса і 10 км ад Вейле).

WikiMatrix

При счете 5:38 в пятом отрезке матча 21-й сеянный турнира оформил серию в

80 очков и сделал счет 3:2, на что его соперник ответил двумя результативными подходами в шестом фрейме — 52 и 67 баллов.

Пры ліку 5:38 у пятым адрэзку матча 21-ы сеяны турніру аформіў серыю ў 80 ачкоў і зрабіў лік 3:2, на што яго сапернік адказаў двума выніковымі падыходамі ў шостым фрэйме — 52 і 67 балаў.

WikiMatrix

И раннее свидетельство этого обнаруживается где- то 80— 120 тысяч лет назад в Африке, где вы обнаруживаете обсидиан, яшму и другие предметы, прошедшие большие расстояния из Эфиопии.

І ранняе сведчанне гэтага выяўляецца дзесьці 80- 120 тысяч год таму ў Афрыцы, дзе мы бачым, што абсыдыян, яшма і іншыя прадметы праходзяць вялікія адлегласці з Эфіопіі.

QED

Но теперь уже объединённые войска Ци и Цинь нанесли ему тяжёлое поражение, обезглавив 80 тысяч воинов.

Але зараз ужо аб’яднаныя войскі Ці і Цынь нанеслі яму цяжкае паражэнне, абезгаловілі 80 тысяч воінаў.

WikiMatrix

В 1818 году отряд британских кораблей, одним из которых командовал Джон Франклин, не сумел преодолеть отметки 80°34′ с. ш.

У 1818 годзе атрад брытанскіх караблёў, адным з якіх камандаваў Джон Франклін, не здолеў пераадолець адзнакі 80° 34′ паўн. ш.

WikiMatrix

Был проведён знаменитый эксперимент по поводу скрытых предубеждений в области гендера в 70-х и

80-х годах.

У 1970х і 1980х быў праведзены славуты эксперымент у сферы несвядомых гендарных перадузятасцей.

ted2019

Z80 и 8-разрядные процессоры MOS 6502 широко использовались в домашних компьютерах и игровых консолях 70-х и 80-х.

Z80 і 8-разрадныя працэсары MOS 6502 мелі папулярнасць у хатніх камп’ютарах і гульнявых кансолях 70-х і 80-х.

WikiMatrix

18 марта презентовала клип Be My Valentine (Anti-crisis girl!).

18 сакавіка прэзентавала кліп Be My Valentine (Anti-crisis girl!).

WikiMatrix

Ему было 80 лет.

Яму было 80 гадоў.

ted2019

%d0%bf%d0%be%d0%b6%d0%b0%d0%bb%d0%be%d0%b2%d0%b0%d1%82%d1%8c — с русского на все языки

Все языкиАбхазскийАдыгейскийАфрикаансАйнский языкАканАлтайскийАрагонскийАрабскийАстурийскийАймараАзербайджанскийБашкирскийБагобоБелорусскийБолгарскийТибетскийБурятскийКаталанскийЧеченскийШорскийЧерокиШайенскогоКриЧешскийКрымскотатарскийЦерковнославянский (Старославянский)ЧувашскийВаллийскийДатскийНемецкийДолганскийГреческийАнглийскийЭсперантоИспанскийЭстонскийБаскскийЭвенкийскийПерсидскийФинскийФарерскийФранцузскийИрландскийГэльскийГуараниКлингонскийЭльзасскийИвритХиндиХорватскийВерхнелужицкийГаитянскийВенгерскийАрмянскийИндонезийскийИнупиакИнгушскийИсландскийИтальянскийЯпонскийГрузинскийКарачаевскийЧеркесскийКазахскийКхмерскийКорейскийКумыкскийКурдскийКомиКиргизскийЛатинскийЛюксембургскийСефардскийЛингалаЛитовскийЛатышскийМаньчжурскийМикенскийМокшанскийМаориМарийскийМакедонскийКомиМонгольскийМалайскийМайяЭрзянскийНидерландскийНорвежскийНауатльОрокскийНогайскийОсетинскийОсманскийПенджабскийПалиПольскийПапьяментоДревнерусский языкПортугальскийКечуаКвеньяРумынский, МолдавскийАрумынскийРусскийСанскритСеверносаамскийЯкутскийСловацкийСловенскийАлбанскийСербскийШведскийСуахилиШумерскийСилезскийТофаларскийТаджикскийТайскийТуркменскийТагальскийТурецкийТатарскийТувинскийТвиУдмурдскийУйгурскийУкраинскийУрдуУрумскийУзбекскийВьетнамскийВепсскийВарайскийЮпийскийИдишЙорубаКитайский

 

Все языкиАнглийскийНемецкийНорвежскийКитайскийИвритФранцузскийУкраинскийИтальянскийПортугальскийВенгерскийТурецкийПольскийДатскийЛатинскийИспанскийСловенскийГреческийЛатышскийФинскийПерсидскийНидерландскийШведскийЯпонскийЭстонскийТаджикскийАрабскийКазахскийТатарскийЧеченскийКарачаевскийСловацкийБелорусскийЧешскийАрмянскийАзербайджанскийУзбекскийШорскийРусскийЭсперантоКрымскотатарскийСуахилиЛитовскийТайскийОсетинскийАдыгейскийЯкутскийАйнский языкЦерковнославянский (Старославянский)ИсландскийИндонезийскийАварскийМонгольскийИдишИнгушскийЭрзянскийКорейскийИжорскийМарийскийМокшанскийУдмурдскийВодскийВепсскийАлтайскийЧувашскийКумыкскийТуркменскийУйгурскийУрумскийЭвенкийскийБашкирскийБаскский

%d0%ba%d0%b0%d0%bb%d0%b8%20%d0%bb%d0%b0%d1%81%d0%ba%d0%b0 — со всех языков на все языки

Все языкиАбхазскийАдыгейскийАфрикаансАйнский языкАканАлтайскийАрагонскийАрабскийАстурийскийАймараАзербайджанскийБашкирскийБагобоБелорусскийБолгарскийТибетскийБурятскийКаталанскийЧеченскийШорскийЧерокиШайенскогоКриЧешскийКрымскотатарскийЦерковнославянский (Старославянский)ЧувашскийВаллийскийДатскийНемецкийДолганскийГреческийАнглийскийЭсперантоИспанскийЭстонскийБаскскийЭвенкийскийПерсидскийФинскийФарерскийФранцузскийИрландскийГэльскийГуараниКлингонскийЭльзасскийИвритХиндиХорватскийВерхнелужицкийГаитянскийВенгерскийАрмянскийИндонезийскийИнупиакИнгушскийИсландскийИтальянскийЯпонскийГрузинскийКарачаевскийЧеркесскийКазахскийКхмерскийКорейскийКумыкскийКурдскийКомиКиргизскийЛатинскийЛюксембургскийСефардскийЛингалаЛитовскийЛатышскийМаньчжурскийМикенскийМокшанскийМаориМарийскийМакедонскийКомиМонгольскийМалайскийМайяЭрзянскийНидерландскийНорвежскийНауатльОрокскийНогайскийОсетинскийОсманскийПенджабскийПалиПольскийПапьяментоДревнерусский языкПортугальскийКечуаКвеньяРумынский, МолдавскийАрумынскийРусскийСанскритСеверносаамскийЯкутскийСловацкийСловенскийАлбанскийСербскийШведскийСуахилиШумерскийСилезскийТофаларскийТаджикскийТайскийТуркменскийТагальскийТурецкийТатарскийТувинскийТвиУдмурдскийУйгурскийУкраинскийУрдуУрумскийУзбекскийВьетнамскийВепсскийВарайскийЮпийскийИдишЙорубаКитайский

 

Все языкиАбхазскийАдыгейскийАфрикаансАйнский языкАлтайскийАрабскийАварскийАймараАзербайджанскийБашкирскийБелорусскийБолгарскийКаталанскийЧеченскийЧаморроШорскийЧерокиЧешскийКрымскотатарскийЦерковнославянский (Старославянский)ЧувашскийДатскийНемецкийГреческийАнглийскийЭсперантоИспанскийЭстонскийБаскскийЭвенкийскийПерсидскийФинскийФарерскийФранцузскийИрландскийГалисийскийКлингонскийЭльзасскийИвритХиндиХорватскийГаитянскийВенгерскийАрмянскийИндонезийскийИнгушскийИсландскийИтальянскийИжорскийЯпонскийЛожбанГрузинскийКарачаевскийКазахскийКхмерскийКорейскийКумыкскийКурдскийЛатинскийЛингалаЛитовскийЛатышскийМокшанскийМаориМарийскийМакедонскийМонгольскийМалайскийМальтийскийМайяЭрзянскийНидерландскийНорвежскийОсетинскийПенджабскийПалиПольскийПапьяментоДревнерусский языкПуштуПортугальскийКечуаКвеньяРумынский, МолдавскийРусскийЯкутскийСловацкийСловенскийАлбанскийСербскийШведскийСуахилиТамильскийТаджикскийТайскийТуркменскийТагальскийТурецкийТатарскийУдмурдскийУйгурскийУкраинскийУрдуУрумскийУзбекскийВодскийВьетнамскийВепсскийИдишЙорубаКитайский

ДОБРО | перевод | Русско-белорусский словарь 1

Русско-белорусский словарь 1



I сущ. в разн. знач. дабро, -ра ср.

это к добру — гэта на дабро

не к добру — не да дабра (не к дабру)

поминать добром — памінаць дабром

II 1) нареч. добра

2) добро бы союз — няхай бы, (хотя бы) хоць бы, (если бы) як хоць

добро пожаловать!

а) (приветствие) з добрым прыбыццём (прыездам, прыходам)!

б) (приглашение) сардэчна запрашаем!, калі ласка!


добро

ДОБРО
перевод с русского языка на белорусский язык в других словарях ► перевод ДОБРО — Русско-белорусский словарь 2

перевод слов, содержащих


ДОБРО,
с русского языка на белорусский язык в других словарях (первые 3 слова)
Русско-белорусский словарь 1► перевод доброволец

добраахвотнік, -ка муж. , дабраволец, -льца муж.

► перевод добровольно

нареч. добраахвотна, дабравольна

► перевод добровольность

добраахвотнасць, -ці жен., дабравольнасць, -ці жен.


Русско-белорусский словарь математических и физических терминов► перевод добротность► перевод добротность механическаядобротность механическая

дыхтоўнасць механічная

► перевод добротность модулированнаядобротность модулированная

дыхтоўнасць мадуляваная


Русско-белорусский словарь 2► перевод добро пожаловать► перевод Добровещение

Дабравесце; Дабравесьце; Дабравешчанне; Дабравешчаньне

► перевод доброволец

валанцёр; добраахвотнік


Дать добро на: Перевод с русского на белорусский, значение, синонимы, антонимы, примеры предложений | Русско-белорусский онлайн-переводчик

Добро пожаловать на вечеринку, мистер Шоу.

Сардэчна запрашаем на вечарыну, містэр Шоў.

Таким образом, это потребители, организующиеся, объединяющие свои ресурсы, чтобы побуждать компании делать добро.

Такім чынам, гэта спажыўцы, якія аб’ядноўваюць свае рэсурсы, каб стымуляваць кампаніі рабіць дабро.

Добро пожаловать в команду Macintosh.

Сардэчна запрашаем у каманду Macintosh.

Добро пожаловать на остров сломанных игрушек.

Сардэчна запрашаем на востраў пабітых цацак.

Добро пожаловать на 10-ю выставку работ художника Пикассо.

Сардэчна запрашаем на 10-ю выставу работ мастака Пікаса.

И мы подумали, что устойчивость превратилась в своего рода неопротестантскую идею о том, что она должна причинять боль, чтобы делать добро.

І мы падумалі, што ўстойлівасць ператварылася ў такі від неапратэстанцкай ідэі, які ёй неабходна балюча, каб рабіць дабро.

Добро пожаловать в семью, Леонард.

Сардэчна запрашаем у сям’ю, Леанард.

Добро пожаловать на обучающий курс для Колфа!

Сардэчна запрашаем на курс падручніка для Кольфа!

Анакин, Асока, добро пожаловать на фестиваль.

Анакін, Асока, запрашаем на фестываль.

Добро пожаловать, постоянный клиент.

Сардэчна запрашаем, пастаянны кліент.

Я не получаю ничего, кроме тех благ, которые мы все пожинаем, когда добро становится злом.

Я не атрымліваю нічога, акрамя карысці, якую мы ўсе атрымліваем, калі дабро становіцца злом.

Добро пожаловать на Global Game Jam 2012.

Сардэчна запрашаем на Global Game Jam 2012.

Добро пожаловать в клуб, свинья.

Сардэчна запрашаем у клуб, свіння.

Добро пожаловать домой, артистка.

Сардэчна запрашаем дадому, мастак.

Добро пожаловать в ночную смену.

Сардэчна запрашаем у начную змену.

Господа, еще раз добрый вечер и добро пожаловать.

Джэнтльмены, зноў жа , добры вечар і дабро запрашаем.

Дамы и господа, добро пожаловать во всемирно известный Rezort.

Шаноўнае спадарства, вітаем у сусветна вядомым Rezort.

Ах. Добро пожаловать обратно в Данию, ваша светлость.

Ах. Зразумела, ваша светласць можа вярнуцца ў Данію.

Ваше Королевское Высочество, добро пожаловать обратно.

Ваша каралеўская мосць, сардэчна запрашаем назад.

Добро пожаловать в мой трейлер на студии.

Сардэчна запрашаем у мой трэйлер на студыі.

Добро пожаловать в Gateway Stakes!

Сардэчна запрашаем у стаўкі шлюза!

Добро пожаловать в IBM, вы огромная успешная компания мэйнфреймов восточного побережья.

Сардэчна запрашаем, IBM, вы велізарная паспяховая кампутарная кампанія на ўсходзе.

Они были как добро против зла.

Яны былі як дабро супраць зла.

Добро против зла, любовь против ненависти.

Дабро супраць зла, каханне супраць нянавісці.

Добро пожаловать на тонущий корабль.

Сардэчна запрашаем на карабель, які тоне.

Хорошо, добро пожаловать в мемориальную клинику Денни Дукетта.

Добра, сардэчна запрашаем у мемарыяльную клініку Дэні Дзюкет.

Добро пожаловать домой, мистер Рейли.

Сардэчна запрашаем дадому, містэр Ролі.

В окружении зла трудно увидеть добро, которое ты делаешь.

Цяжка ўбачыць дабро, якое ты робіш, калі ты акружаны злом.

Добро пожаловать домой!

Сардэчна запрашаем дадому!

Добро пожаловать в наш клуб.

Мы вітаем вас у нашым клубе.

Добро пожаловать в наш дом!

Сардэчна запрашаем у наш дом!

Отличить добро от зла ​​непросто.

Няпроста адрозніць дабро ад зла.

Добро пожаловать в Японию.

Сардэчна запрашаем у Японію.

Добро пожаловать.

Вы верите, что добро всегда побеждает зло?

Вы верыце, што дабро заўсёды перамагае зло?

В конечном итоге он будет производить только добро.

У перспектыве гэта выльецца толькі з дабра.

Моя страна — это мир, а моя религия — делать добро.

Мая краіна — гэта свет, і мая рэлігія — рабіць дабро.

Добро пожаловать в новое поколение беспилотных автомобилей.

Сардэчна запрашаем у наступнае пакаленне аўтаномных транспартных сродкаў.

Все существа пьют радость в груди природы; все добро, все зло идет по ее следу роз.

Усе істоты п’юць радасць на грудзях прыроды; усё добра, усё зло ідзе па яе следзе руж.

Ты помышлял против меня зло, но Бог обратил его в добро, чтобы возвысить меня, как теперь видишь, и спасти многих людей.

Вы лічылі зло супраць мяне: але Бог ператварыў гэта ў дабро, каб мог узвысіць мяне, як цяпер вы бачыце, і выратаваць многіх людзей.

Вы не можете сделать добро слишком рано, потому что никогда не знаете, как скоро будет слишком поздно.

Вы не можаце зрабіць дабрыню занадта хутка, бо ніколі не ведаеце, як хутка будзе позна.

Здравствуйте, мистер и миссис Мюллер! Меня зовут Том. Я-марсианин. -О, добро пожаловать, том! Заходите и выпейте с нами чашечку чая!»

Добры дзень, містэр і місіс Мюлер! Мяне завуць Том. Я марсіянін. «О, прывітанне, Том! Заходзь і далучайся да нас за кубкам гарбаты!»

Каждое политическое добро, доведенное до крайности, должно быть продуктивным для зла.

Кожнае палітычнае дабро, даведзенае да крайнасці, павінна прыносіць зло.

Наши сомнения-предатели, и они заставляют нас терять добро, которое мы часто могли бы завоевать, боясь сделать попытку.

Нашы сумневы — здраднікі, і прымушаюць нас страціць дабро, якое мы часта можам перамагчы, баючыся паспрабаваць.

Добро пожаловать, сэр Генри! Добро пожаловать в Баскервиль-холл!

Сардэчна запрашаем, сэр Генры! Сардэчна запрашаем у Баскервіль Хол!

Если вы способны делать добро для кого-то, то не сдерживайтесь.

Калі вы здольныя зрабіць для кагосьці дабро, не стрымлівайцеся.

Тот, кто смешивает добро и зло, является врагом добру.

Той, хто блытае дабро і зло, з’яўляецца ворагам дабра.

Привет ребята! Добро пожаловать на другое видео на моем канале YouTube.

Прывітанне, хлопцы! Сардэчна запрашаем у іншае відэа на маім канале YouTube.

Только мудростью можно отличить добро от зла; только смирением можно построить счастливую жизнь.

Толькі з дапамогай мудрасці можна адрозніць дабро ад зла; толькі з пакорай можна пабудаваць шчаслівае жыццё.

Я не верю в Бога теологии, который награждает добро и наказывает зло.

Я не веру ў Бога багаслоўя, які ўзнагароджвае дабро і карае зло.

Ты сказал, что сделаешь мне добро и умножишь мое семя, как песок морской, который не может быть исчислен во множестве.

Ты сказаў, што зробіш добра са мною і памножыш насеньне маё, як марскі пясок, якога немагчыма пералічыць.

Первая тюрьма, которую я когда-либо видел, была начертана на ней: «перестань делать зло: учись делать добро»; но так как надпись была снаружи, заключенные не могли ее прочесть.

Першая турма, якую я калі-небудзь бачыў, напісаў на ёй ПРЫЙМІЦЬ ЗЛО: НАВУЧЫЦЕСЯ Добра рабіць; але паколькі надпіс быў звонку, зняволеныя не маглі яго прачытаць.

Добро пожаловать. Теперь, когда прибыло много людей, пожалуйста, присаживайтесь и подождите немного.

Сардэчна запрашаем. Цяпер, калі прыбыло шмат людзей, сядзьце і пачакайце крыху.

Добро пожаловать в Википедию, бесплатную энциклопедию, которую может редактировать каждый.

Сардэчна запрашаем у Вікіпедыю — бясплатную энцыклапедыю, рэдагаваць якую можа кожны.

Я не уверен, что уже приветствовал тебя в Татоэбе. Так что, возможно, во второй раз: добро пожаловать!

Я не ўпэўнены, што я ўжо сустракаў вас у Татуебе. Таму, магчыма, другі раз: Сардэчна запрашаем!

Не знаю, чего бы вы от меня хотели, но добро пожаловать.

Я не ўпэўнены, што вы хацелі б ад мяне, але вы можаце ў гэтым рады.

Наши сомнения-предатели, и они заставляют нас терять то добро, которое мы часто могли бы завоевать, боясь сделать попытку.

Нашы сумневы з’яўляюцца здраднікамі і прымушаюць страціць дабро, якое мы часта можам выйграць, баючыся паспрабаваць.

Когда я делаю добро, я чувствую себя хорошо. Когда я делаю плохо, я чувствую себя плохо. Это моя религия.

Калі я раблю дабро, я адчуваю сябе добра. Калі я раблю дрэнна, мне дрэнна. Гэта мая рэлігія.

Добро пожаловать в Tatoeba, текилу, секс и марихуану.

Сардэчна запрашаем у Tatoeba, тэкілу, сэкс і марыхуану.

Никто не выбирает зло потому, что оно есть зло; он только ошибочно принимает его за счастье, за то добро, которое ищет.

Ніхто не выбірае зло, бо яно зло; ён памыляецца толькі для шчасця, дабра, якога шукае.

Добро пожаловать в штаб вашей кампании.

Сардэчна запрашаем у ваш выбарчы штаб.

Добро пожаловать на телетрансляцию церемонии открытия Олимпийских игр из Пекина!

Сардэчна запрашаем у эфір цырымоній адкрыцця Алімпіяды з Пекіна!

Добро пожаловать в оазис верблюдов, особый день рождения в честь мисс Сары Крэндалл.

Сардэчна запрашаем у аазіс вярблюдаў, п. Оў, адмысловая вечарына на дзень нараджэння ў гонар міс Сары Крэндал.

Здравый смысл подсказывал ему, что ложь и уклонение от исполнения долга-грехи. С другой стороны, все знали, что грех-это зло, и что никакое добро не может произойти от зла.

Здаровы сэнс сказаў яму, што гаварыць хлусню і адмаўляць ад абавязку былі грахі. З іншага боку, усе ведалі, што грэх — зло і што ад зла не можа выйсці.

Добро пожаловать на торжественное открытие нашего whatchamacallit, который, благодаря лоббированию Лизы Симпсон, мы построили вместо нового бейсбольного стадиона.

Сардэчна запрашаем на ўрачыстае адкрыццё нашага Whatchamacallit, які, дзякуючы лобізму Лізы Сімпсан, мы пабудавалі замест новага бейсбольнага стадыёна.

Но он дал мне добро на постройку полноценной винтовки.

Але ён даў мне знак, каб убудаваць яго ў поўную вінтоўку.

Добро пожаловать в апокалипсис, мистер Сквидвард.

Сардэчна запрашаем у апакаліпсіс, містэр Сквидвард.

Добро пожаловать в путешествие Ричарда, чтобы узнать, почему он такой, какой он есть.

Сардэчна запрашаем у падарожжа Рычарда, каб даведацца, чаму ён такі, які ёсць.

Лейтенант Делькур, добро пожаловать на заставу Афгар.

Лейтэнант Дэлькур, вітаем на Афгары.

Добро пожаловать в окаменевший лес, крупнейшую в мире часть окаменелой древесины.

Сардэчна запрашаем у скамянелы лес, у свеце bigstslte з прафіцыраванага дрэва.

Холостяк, достойный титула. Добро пожаловать в Санри!

Халасцяк варты звання. Сардэчна запрашаем у Санры!

Добро пожаловать на футбольный матч вооруженных сил 2011 года-ежегодное благотворительное мероприятие, объединяющее все пять родов войск.

Сардэчна запрашаем на Футбольны матч Узброеных Сіл 2011 года, штогадовую дабрачынную акцыю, якая аб’ядноўвае ўсе пяць ваенных аддзяленняў.

о, привет, добро пожаловать в здание. Да.

о, прывітанне, сардэчна запрашаем у будынак. так.

Добро пожаловать в Старый Призрак, ребята.

Сардэчна запрашаем у Old Haunt, людзі.

«Ненавижу чистоту, ненавижу добро!

» Я ненавіджу чысціню, ненавіджу дабро!

И, готовя вас к тому, что произойдет, принимаете вы это или нет, я сделал вам сегодня добро.

І рыхтуючы вас да таго, што прыйдзе, прымаеце вы гэта ці не, я сёння зрабіў вам дабрыню.

Добро пожаловать в Технологический институт Южного Хармона!

Сардэчна запрашаем у Тэхналагічны інстытут Паўднёвага Гармона!

-И я позволю тебе застрелить меня, и добро пожаловать, — сказал я. — Это такое же хорошее место для прыжка, как и любое другое.

«І я б дазволіў вам застрэліць мяне і вітаць», — сказаў я. «Гэта для мяне гэтак жа добрае месца для перасадкі.

Добро пожаловать в ФБР, малыш.

Сардэчна запрашаем у ФБР, малы.

Распространенные фразы на белорусском языке | OpenTran — Онлайн-переводчик & словарь

Фраза Перевод Транслитерация на русском
Представьте нам, пожалуйста, членов вашей делегации (ваших друзей)! Прадстаўце нам, калі ласка, членаў вашай дэлегацыі (вашых сяброў)! Прадстауте нам, калиласка, членау вашай дэлегацыи (вашых сяброу)!
Добро пожаловать к нам в гости! Сардэчна запрашаем да нас у госці! Сардэчна запрашаем да нас у гости!
Нам здесь очень понравилось! Нам тут вельмі спадабалася! Нам тут вельми спадабалася !
Мы вам очень благодарны за приглашение! Провести время вместе с вами и разделить радость этого события – большая честь для нас! Мы Вам вельмі ўдзячны за запрашэнне! Правесці час разам з вамі і падзяліць радасць гэтай падзеі – вялікі гонар для нас! Мы вельми удячны за запрашэнне! Правесьти час разам з вами и падялить радасть гэтай падеи – вялики гонар для нас!
Рад приветствовать уважаемых гостей на открытии нашей выставки! Рады вітаць паважаных гасцей на адкрыцці нашай выстаўкі! Рады витать паважаных гасьтей на аткрыттинашай выстауки!
Сколько людей состоит в вашем национальном обществе? Колькі людзей налічвае ваша нацыянальнае таварыства? Кольки людей наличвае ваша нацыянальнае таварыства ?
Вам понравились выступления наших национальных песенных и музыкальных коллективов? Вам спадабаліся выступленні нашых нацыянальных песенных і музычных калектываў? Вам спадабалися выступленни нашых нацыянальных песенных и музычных калектывау?
Нам очень понравилось на вашем празднике! Нам вельмі спадабалася на вашым свяце! Нам вельми спадабалася на вашым сьвяте!
Покажите нам, пожалуйста, изделия ваших народных промыслов. Пакажыце нам, калі ласка, вырабы вашых народных промыслаў. Пакажыте нам, калиласка, вырабы вашых народных промыслау.
Спасибо за тёплый и сердечный приём! Дзякуй за цёплы і сардэчны прыём! Дякуй за тёплы и сардэчны прыём!

Африканские хлопцы полюбили драники — Союзное Вече

«Спадчына» — в переводе означает » наследие». Ребята хотят сохранить то, что им передали предки. Фото: rudn.ru


В РУДН обучаются представители 450 национальностей и народностей из 146 стран мира.

— У нас больше 150 различных сообществ. Интернациональные организации, студенческие советы, совет студенческого городка, Женский комитет, 107 землячеств, — рассказал начальник управления вуза по работе со студентами Александр Ермаков.

Сейчас в вузе учится больше полусотни студентов из Беларуси. Это не так много по сравнению с другими объединениями. У белорусской ассоциации «Спадчына» есть даже свой президент, вице-президент по организационным вопросам и множество ответственных за учебу, внешние связи и досуг. Два раза в семестр — общие собрания. Так что берут не числом, а умением.

Как проявляют себя студенты из Синеокой? На праздниках устраивают национальные выставки, танцуют и поют на родном языке. На фестивале «Нас подружила Москва» в прошлом году их признали «Открытием года». Ребята организовали стенд с рушниками знаменитых «Слуцких ткачих», смастерили кукол в народных костюмах. Всех угощали белорусскими конфетами. Теперь весь университет знает приветствие «Сардэчна запрашаем!» (сердечно приглашаем! (бел.)


Студенты организуют «Вкусные фестивали» и вечера белорусской культуры, на которых готовят национальные блюда и угощают всех желающих. Ни один драник на тарелке не залежался. Особенно быстро их сметали африканские парни и девчата — эка диковинка!

Есть и негромкие, но важные дела. Ребята ездят в детские дома сел Лухтеново и Ляхи, где устраивают праздники для детей-сирот.

ОПРОС «СВ»


Что говорят иностранные студенты о Беларуси?

Александра Мартыненко, Украина:

— Я знаю про местную клюкву в сахаре. Также знаю город Бобруйск — почему-то туда очень хочется, из-за названия, наверное. Слушаю вашу певицу Полину Республику. Знаю, что белорусский рубль когда-то называли «зайчиком», а недавно отменили миллионы.

Блерина Махмутай, Албания:

— Два государственных языка — белорусский и русский. Люди умные и активные, всегда помогают друг другу. Гордые, как и сама страна. Знаю, что президент у них Лукашенко.

Инна Галер, Латвия:

— Слышала, что в Беларуси дешевый бензин. Знаю, что такое бульба. По фото видела, насколько красивые Минск и Витебск. И какая прекрасная атмосфера во время «Славянского базара». Белорусы — гостеприимный народ.

Сакко Бекай, Мали:

— Я слышал, что президент в Беларуси очень строгий. Год назад мой друг жил в Беларуси, он мне рассказал, что там очень чистые города и натуральные продукты.

Владислав Пурцхванидзе, Грузия:

— Беларусь — независимая республика. Столица — Минск. Очень красивая страна. С ухоженными чистыми улицами. С воспитанными и культурными жителями. Наслышан о белорусском картофеле.

Наталия Мартинес, Колумбия:

— Знаю IVANа, который пел на «Евровидении». Национальное блюдо — картошка. Еще Беларусь была в составе СССР. Думаю, что там холодно. Девушки очень красивые, со светлыми глазами.

Мария Васильева, Россия:

— Граничит с Россией и Украиной. Экономика — индустриальная с упором на сельское хозяйство. Президента все знают. Белорусы — люди добрые и открытые. Ассоциации: картошка, очень вкусная национальная кухня и футбольные команды «Динамо-Минск» и БАТЭ. И еще Депардье туда приезжать любит, траву косить.



Даже горячие парни с берегов Нила с удовольствием танцуют народный танец «Крыжачок». Фото: rudn.ru

dare to dance — испанский перевод — Linguee

Это не очень хорошо воспринимается

[…] Milonguero s t o dare to танец i n f oo r без [. ..]

умеет адекватно управлять.

culturacercana.com.ar

Est muy mal visto por

[…] los Milongu er os, aventurarse en una p ista sin saber […]

manejarse adecuadamente.

culturacercana.com.ar

Эта постоянная ритмическая двусмысленность — вот что правильно объясняет

[…]

титул этой сарданы, тот, что нет

[…] cobla band w ou l d dare t o p ut in a 9000 og ramme, но […]

, который стал эталоном как

[…]

Концертная пьеса в форме сарданы.

dinsic.es

Esta constante ambigedad rtmica es la que, con razn ,termina el ttulo de esta

[…]

sardana que ninguna cobla se

[…] atrevera a prog ra mar e n u n baile, per o que c onstituye una [. ..]

muestra de audacia y de originalidad,

[…]

y que se ha convertido en un referente como pieza de concierto escrita en forma de sardana.

dinsic.es

Молодые женщины принимали участие во всем: от групповых дискуссий, посвященных изучению теории и практики лидерства в их организациях, до

[…]

многоязычная группа поют

[…] песни вокруг сердечного лагеря ir e , dare d e vi l приключенческие мероприятия a и a n d вечернее мероприятие с добавлением пищи.

wagggs.org

Desde Discusiones grupales enfocadas a analizar teoras y prcticas de liderazgo dentro de sus asociaciones hasta

[…]

cantar alrededor de la

[…] gran fog at a en v ar ias lenguas, actividades de aventura, y un evento noctur no colm ado de baile y comi 0007.

wagggs.org

Вот что произойдет, если y o u dare t o d стопка.

aarpsegundajuventud.org

Eso es lo que

[…] pasa cua nd o uno se atreve a s весло «.

aarpsegundajuventud.org

Нам нужно

[…] поддерживайте то, что работает, но нам также необходимо d t o dare t o s пик, если некоторые вещи не подходят.

europarl.europa.eu

Hemos de respaldar lo positivo, pero atrevmonos tambin a desaprobar lo negativo.

europarl.europa.eu

Надеюсь, что к концу года мы сможем

[…] скажем «да» мы вернемся al l y dare t o b e разное.

fimcap. org

Ojal que a fin de ao podamos decir

[…] «s», rea lm ente nos atrevimos a s er di fe rentes.

fimcap.org

Ла Льорона от завоеваний до двухсотлетия

[…]

— шоу современной музыки

[…] с доиспанским элементом nt s , танец p r e- Испанская хореография […]

и живой театр.

mbw.com.mx

La llorona, de la conquista al bicentenario, es un

[…]

espectculo concado por msica contempornea con

[…] elemen to s prehispnicos, core ograf as de danza pre his pnic a y teatro […

en vivo.

mbw.com.mx

Есть

[…] еще много w h o dare n o t произнести это [. ..]

публично.

jordipujol.cat

En pblico

[…] todava hay qu ien n o s e atreve a de cirlo .

jordipujol.cat

Зная, как w t o dare , l ad лет и господа, […]

абсолютно необходим для корректировки нашего текущего курса.

unesdoc.unesco.org

S ab er atreverse , e s abs ol utamente […]

незаменимых, seoras y seores, para rectificar los presentes rumbos.

unesdoc.unesco.org

А, наоборот,

[…] Африканцы тоже, mu s t dare t o l до их […]

обязанностей.

daccess-ods.un.org

Sin embargo, a su vez, los africanos

[. ..] tambi n debe n asumir s us re sp onsabilidades.

daccess-ods.un.org

Они любят e t o танец t o m usic, пойте песни, […]

бега и вовлекайте друг друга и их учителя в игру.

Healthychildcarenc.org

A estos nio s les g ust a bailar a l r itmo de la msica, […]

cantar canciones, correr y hacer que otros nios y su maestra Participen en el juego.

Healthychildcarenc.org

Мы никогда не будем abl e t o dance a n d пойте так же, как они!

fimcap.org

Носотрос

[…] nunca sere mo s cap ace s d e bailar y ca nta r com o ellos!

fimcap. org

Женщина должна обслуживать a n d танец t o t мелодия мужа, точка.

ipas.org

La mujer est ah para servir al hombre y hacer l o que l quiere, punto.

ipas.org

Музыка и

[…] караоке пригласить d t o танец a n d петь вместе.

samuel.de

La msica y el

[…] караоке i nvita ron a bailar y a c antar .

samuel.de

Те w h o dare , t he самые инновационные […]

может с гордостью посмотреть в зеркало и сказать себе, что они оказались на высоте.

terre-citoyenne.org

L as que se atrevan , l as m s innovadoras [. ..]

podrn mirarse al espejo con orgullo y decirse a s mismas que han estado a la altura.

terre-citoyenne.org

Мы, как представители

[…] международное сообщество, mu s t dare t o a sk эти критические […]

вопросов.

daccess-ods.un.org

Nosotros, como Representantes de la comunidad

[…] internacion al , deb emo s atrevernos a fo rmula r estos […]

interrogantes crticos.

daccess-ods.un.org

Чавес делает n o t dare t e ll страна […]

правда.

english.alertavenezuela.com

Chvez n o se atreve a de ci rle al […]

pas la verdad.

alertavenezuela. com

Во многих областях — социальной, экономической и экологической — мы повторяем

[…]

диагностирует и пишет все новые и новые отчеты,

[…] потому что мы делаем n o t dare i m pl ement правильное […]

мер — правильное обращение — который

[…]

становится все более актуальным с каждым днем.

unesdoc.unesco.org

En muchos aspectos-sociales, econmicos, de medio ambiente- estamos reiterando los diagnsticos,

[…]

estamos haciendo informes y ms informes,

[…] porqu e no no s atrevemos a apli ca r las […]

medidas correkas, los tratamientos adecuados, cada da ms urgentes.

unesdoc.unesco.org

Еще неизвестно, действительно ли правительство США шло или l d осмелившимся t o s eek конфронтацией с Китаем.

robeco.com

An est por verse si el gobierno de EE. UU. s e atrever r ealmente a buscar una confrontacin con China.

robeco.com

Явное большинство из

[…] потребители не уверены в своей позиции на t h e dance f l oo r торговли.

europarl.europa.eu

La Clara Mayora de

[…] lo s ciudadanos s e sienten insguros en la pi sta de baile de l co me rcio.

europarl.europa.eu

Это предполагает использование

[…] древнеиндийская система m o f танец , N at ya shastra.

lovingheartcentre.net

Involucra el uso

[…] del anti gu o sis tem a d e danza H ind , el Na ty a shastra.

lovingheartcentre.net

Ta ki n g dance c l as ses и другие встречи […]

женщин помогли мне увидеть выход.

aarpsegundajuventud.org

Tom ar clas es de baile y con ocer a otras […]

mujeres me ayud a entender que haba una salida «.

aarpsegundajuventud.org

Вы будете брать уроки сальсы и

[…] вы узнаете n t o dance s t ep до свидания, шаг.

sinfronterasspanishschool.org

T tomars lecciones de

[…] salsa y a pr ende rs a bailar p aso a pa so .

sinfronterasspanishschool.org

Параш, работавший актером и певцом

[. ..] в то время, турне d t o танец a f te r три месяца […]

физиотерапевтов, покрываемых его страховкой, закончились.

aarpsegundajuventud.org

Parache, que en aquella poca trabajaba como

[…] y cant an te, e mpe z a bailar l ueg o d e tre s meses […]

de terapia fsica, momento en que se venci su seguro mdico.

aarpsegundajuventud.org

Мне также нравится e t o танец m a rt inetes a n d например ras наполняет меня жизненной силой.

esflamenco.com

Me gusta ta mbin bailar por m ar tinetes y me lleno de m uc ha vi da bailando po

esflamenco. com

Вот и узнал сколько у меня

[…] также очень люблю e t o танец !

мед.com

Y aqu tambin he

[…] descubierto cu n to m e gu st a bailar !

medel.com

Действительно, эти w h o dare t o i gnore их история […]

обречены его повторить.

daccess-ods.un.org

Quiene s osen h acer c as o omiso d e su history […]

естьн конденадос репетирла.

daccess-ods.un.org

Другие аналитики говорят, что

[…] те авторы ti e s dare n o t проезд 5 км […]

за пределами некоторых муниципальных центров.

crisgroup. org

Otros analistas afirman que esas mismas

[…] autori da des no se atreven a viajar […]

5 км от муниципалитета Альгунас Кабесерас.

crisgroup.org

Я думал ‘h o w dare s h e неуважение […]

мне это нравится »и« Мне нужно преподать ей урок.

4children.org

Pensaba que ‘cm o se atreve a fa ltarme as […]

el respeto ‘y’ necesito ensearle una leccin ‘».

es.4children.org

Потому что он wi l l dare t o g o где никто другой не рискнет.

businesschile.cl

Porque se atraver a ir donde nadie ms se aventurar.

businesschile.cl

best times — Перевод на испанский — примеры английский

Эти примеры могут содержать грубые слова, основанные на вашем поиске.

Эти примеры могут содержать разговорные слова, основанные на вашем поиске.

лучшее время для — это период с марта по октябрь.

Весна и осень, как правило, лучшее время для посещения Кардиффа.

El mejor momento para visitar la ciudad es durante la primavera o el otoño.

Это были одни из лучших времен года.

У нас было лучших раза с этими тако, Шон.

Подумайте … если кто-то скажет вам, что ваши лучшие времена прошли.

Спасибо за лучших времен когда-либо.

Панис опустился на четвертое место, опередив Герхарда Бергера, их лучших результата разницей в одну десятую секунды.

Panis se deslizó al cuarto lugar por delante de Gerhard Berger, sus mejores tiempos con una décima de segundo de Diferencia.

Некоторые из наших лучших времен вместе всегда были связаны с большой трапезой.

Первая проба состоит из десяти кругов … и четырех лучших времен остаются.

La primera prueba consiste en diez vueltas, y los cuatro mejores tiempos van a seguir en comptencia.

лучших времен для вашего возраста.

Этот инструмент дает вам полную разбивку из лучших времен для твита.

Esta herramienta te da un Complete desglose de los mejores momentos para hacer un tweet.

«Путешествие было для меня лучших времен с внуками», — заключает она.

Весна (январь-июнь) — лучшие времена для таких севооборотов.

Primavera (enero-junio) es el mejor momento para dichas rotaciones.

Воспользуйтесь одним из лучших времен дня для наблюдения за дикой природой.

Раннее утро и вечер — лучшее время для наблюдения за дикой природой.

Las horas temprano en la mañana y antes del oscurecer son los mejores tiempos para la observación de animales.

лучшие времена , чтобы увидеть настоящую Сардану, приходятся на фестиваль.

лучшее время для кратома может варьироваться в зависимости от некоторых индивидуальных параметров.

El mejor momento para tomar kratom depende de ciertos parámetros Individual.

Сумма лучших результатов по каждой команды определит результат.

Los mejores tiempos combinados de cada equipoterminarán los resultados.

В лучших временах провинции было 5 Братьев.

Дневная рыбалка на окуня иногда может быть лучшим временем для рыбалки на озере Окичоби.

Tarde de pesca bajo a veces puede ser el mejor momento para pescar en el lago Okeechobee.

Фаготиста на английском языке с контекстными примерами

Испанский

A Principios de 2010 me reencontré con Marc Riera, fagotista y amigo mío del Esmuc, que es el intérprete de flabiol de la Cobla Sabadell, y le propuse de escribir y dedicarle una sardana Obligada de flabiol, con la petición de que su cobla me el estreno, y cuando recibí su acuerdo y el de su Cobla, me puse a trabajar en este desafío y con gran alegría ví que la cosa iba funcionando.

Английский

В начале 2010 года я встретился с Марком Риерой, фаготистом и моим другом из ESMUC, который является флабиолистом на Кобла Сабадель, и сделал ему предложение написать для него сардану «обязгада» (это сардана с одним инструментом, играющим сложный отрывок в качестве солиста, в данном случае флабиол), с просьбой, чтобы его кобла представила произведение, так что, когда я получил его согласие и согласие от коблы, я начал над ним работать.Я очень обрадовался, когда понял, что МОГУ ЭТО СДЕЛАТЬ. Наконец работа была закончена и состоялась премьера.

Последнее обновление: 2018-02-13
Частота использования: 1
Качество:
Ссылка: Andrm
Предупреждение: содержит невидимое форматирование HTML.

этнических групп в Испании | Кастильский, каталонский, баскский

Испания развивалась как нация с разнообразными этническими группами, которые жили на Пиренейском полуострове с древних времен.В современной Испании есть другие этнические группы, чем те, которые существовали на Пиренейском полуострове, из-за иммигрантов из стран Азии, Ближнего Востока, Европы и Африки. Этнические группы в Испании, которые жили в Испании с древних времен, включают:

  • Арагонцы
  • Андалузцы
  • Астурийцы
  • Баски
  • Canary Islanders
  • кастильцы
  • Каталонцы
  • Кантабрийцы
  • Эстремадуранцы
  • Галичане
  • цыгане

Из них следующие являются крупнейшими этническими группами в Испании: кастильцев , каталонцев , басков , галичан и валенсийцев .

кастильцы

Королевство Кастилия и королевство Арагон на Пиренейском полуострове были объединены в современную Испанию. Этническая группа кастильцев в Испании является потомком Королевства Кастилия. После образования Королевства Испании кастильцы были одной из этнических групп в Испании, которые доминировали из-за их широкого присутствия по всему государству.

Культура кастильцев, а также их язык оказали такое влияние на испанскую культуру, что сегодня иностранцы считают кастильский язык испанским.Конституция Испании предоставила кастильскому языку официальный статус. Кастильская этническая группа в Испании в основном исповедует римско-католическую веру.

Каталонцы

Каталонцы представляют провинции северо-восточного региона Испании. Провинции, в которых сконцентрировано каталонское население, включают Барселону, Таррагону, Лериду и Жирону. Эти провинции вместе образуют автономное сообщество Испании под названием Каталония со столицей в Барселоне.Поскольку Каталония расположена недалеко от Франции, во Франции проживает несколько каталонцев.

Каталонцы обычно говорят на каталонском диалекте или валенсийском диалекте, который является вариантом каталонского. Каталонский язык является одним из официальных языков Испании, на нем также говорят каталонцы во Франции. Есть каталонцы, которые также общаются на испанском и французском языках.

Религия большинства каталонцев — католицизм, некоторые также исповедуют атеизм и агностицизм.Некоторые из важных аспектов каталонской традиции включают соревнования по строительству человеческих башен под названием Кастелл и танец Сардана.

Басков

Этническая группа басков в Испании существует уже несколько тысяч лет в регионе, который сейчас является частью современной Южной Франции и Северной Испании. Они считаются одной из древнейших этнических групп Европы. Баски в Испании сегодня сосредоточены в автономном сообществе Страна Басков и провинции Наварра.

В современной Испании проживает более двух миллионов басков. Этническая группа басков в Испании исповедует религию римского католицизма. Баски были связаны с сельскохозяйственной промышленностью. Это причина, по которой эта этническая группа в Испании работает на ранчо, в рыболовстве или на козьих фермах.

Галичане

Галичане называют северо-запад Пиренейского полуострова своим домом, где проживает около 3 миллионов галичан. Галичане произошли от второй волны кельтских захватчиков в Испанию с Британских островов, а также из Западной Европы, которые пришли примерно в 400 г. до н.э. через Пиренейские горы.

Римляне победили местное кельтское племя во втором веке до нашей эры, дав галичанам свое имя, которое произошло от латинского слова Gallaeci. Галичане известны своей любовью к еде, особенно к морепродуктам и рыбе, а также умением строить лодки. В Галисии по-прежнему преобладают сельское, сельское и сельское общество и образ жизни, где галицкий язык и культура процветают и сегодня.

Валенсийцы

Строго говоря, валенсийцы — это люди, которые проживают в валенсийском сообществе, но валенсийцы — это гораздо больше, чем просто место их проживания.Валенсийский язык официально является разновидностью каталонского, который описывается как отдельный диалект, но в Валенсии существуют разногласия по поводу его статуса, поскольку многие считают, что это язык сам по себе.

В течение 13 -го -го века Каталония изгнала мусульман из Валенсии, и в этот момент произошло рождение валенсийского языка, хотя неясно, произошел ли этот язык от арабских букв латинского алфавита или он появился раньше их правления до старой версии Окситанский.

В любом случае, на этом языке по-прежнему говорят и преподают в школах, и он широко распространен в городах на побережье. В настоящее время жители Валенсии работают в основном в туристических секторах, тепло обслуживая путешественников в этот регион, но они также являются домом для паэльи, ярких фестивалей и потрясающих произведений искусства.

Испанские диалекты

Узнайте больше о различных вариантах испанского языка, на которых говорят в разных странах.

Адаптерный белок метилтрансферазы Trm112 участвует в биогенезе обеих рибосомных субъединиц.

Abstract

Мы ранее идентифицировали Bud23 как метилтрансферазу, которая метилирует G1575 рРНК в P-сайте малой (40S) рибосомной субъединицы.В этой статье мы показываем, что Bud23 требует адаптерного белка метилтрансферазы Trm112 для стабильности in vivo. Делеция Trm112 приводит к bud23Δ -подобному мутантному фенотипу. Таким образом, Trm112 необходим для эффективного биогенеза малых субъединиц. Генетический анализ предполагает, что медленный рост мутанта trm112Δ обусловлен в первую очередь потерей Bud23. Неожиданно подавление bud23Δ -зависимого дефекта 40S выявило большой (60S) дефект биогенеза у мутанта trm112Δ .Используя седиментационный анализ в градиенте сахарозы и коиммунопреципитацию, мы показали, что Trm112 также участвует в биогенезе 60S субъединицы. Дефект 60S может зависеть от Nop2 и Rcm1, двух дополнительных взаимодействующих Trm112, которые мы идентифицировали. Наша работа расширяет известный диапазон функции Trm112 от модификации тРНК и факторов трансляции до обеих рибосомных субъединиц, показывая, что его эффекты охватывают все аспекты машины трансляции. Хотя Trm112 необходим для стабильности Bud23, наши результаты предполагают, что Trm112 не поддерживается в стабильном комплексе с Bud23.Мы предполагаем, что Trm112 стабилизирует своих свободных партнеров-метилтрансфераз, не взаимодействующих с субстратом, и / или помогает доставить своих партнеров-метилтрансфераз к их субстратам.

ВВЕДЕНИЕ

РНК играет ключевую роль во многих клеточных процессах. Следовательно, регуляция синтеза, сворачивания и процессинга видов РНК является неотъемлемой частью регуляции клеточных функций. Посттранскрипционные модификации во время процессинга возникающих транскриптов РНК-предшественников уже давно предполагается, что они являются механизмами, которые модулируют функцию или стабильность РНК и влияют на экспрессию генов (Helm, 2006).Метилирование РНК — одна из таких часто наблюдаемых модификаций, о которой сообщалось в рРНК, тРНК, мРНК, малой ядерной РНК, малой ядрышковой РНК (мяРНК), тмРНК и микроРНК, а также вирусной РНК. Метилирование РНК может происходить в различных положениях азотистого основания, а также в сахаре рибозы.

рРНК подвергаются нескольким посттранскрипционным модификациям, в частности метилированию оснований, метилированию 2′- O -рибозы и псевдоуридилированию. Большинство этих модификаций локализовано в функционально важных центрах рибосомы — центре пептидилтрансферазы и центре декодирования (Decatur and Fournier, 2002).Однако большой процент этих модификаций рРНК не является существенным по отдельности и, как считается, регулирует эффективность и точность процесса трансляции. В то время как большинство модификаций рРНК представляют собой метилирование и псевдоуридилирование 2′- O -рибозы, на которые нацелены мяноРНК C / D-box и snoRNA H / ACA-box с использованием обычных модифицирующих ферментов, метилирование оснований обычно катализируется специфическим S — аденозилметионин (SAM) -зависимые метилтрансферазы (Henras et al., 2008).

Маленькая субъединица (40S) 18S рРНК в Saccharomyces cerevisiae содержит только три метилирования оснований. Два из них, в положениях A1781 и A1782, катализируются Dim1 (Lafontaine et al. , 1994). Dim1 важен для жизнеспособности, но не катализируемое им метилирование (Lafontaine et al. , 1995). Третье основание, метилирование в положении G1575, катализируется Bud23 (White et al. , 2008). Метилированный гуанозин расположен в Р-сайте малой субъединицы, и его метилирование сохраняется у всех эукариот.Однако, подобно Dim1 и несмотря на его, по-видимому, важное расположение, метилирование G1575 также несущественно (White et al. , 2008). Большая субъединица (60S) 25S рРНК содержит по крайней мере шесть метилирований оснований (Piekna-Przybylska et al. , 2007), но ни одна из метилтрансфераз, ответственных за эти модификации, не охарактеризована.

РНК переноса также претерпевают множество модификаций, включая метилирование нескольких оснований. Метилтрансферазы, ответственные за некоторые из этих метилирований, были идентифицированы (Dunin-Horkawicz et al., 2006). Интересно, что по крайней мере две из SAM-зависимых тРНК метилтрансфераз (Trm9 и Trm11), как было показано, взаимодействуют с маленьким белком цинкового пальца Trm112 (Purushothaman et al. , 2005; Studte et al. , 2008). Кроме того, было показано, что Trm112 является коактиватором Mtq2, белка, который метилирует фактор терминации трансляции, eRF1 (Heurgue-Hamard et al. , 2006; Liger et al. , 2011). В случае Mtq2 для его стабильности также требуется Trm112.Все известные метилтрансферазы-партнеры Trm112 относятся к одному семейству из семи белков β-цепи. Таким образом, Trm112, по-видимому, играет общую роль в облегчении функции множественных метилтрансфераз, влияющих на разные аспекты трансляции.

В этой работе мы предоставляем доказательства, что Trm112 также действует в биогенезе рибосом, как коактиватор для Bud23 в биогенезе 40S и в биогенезе 60S, вероятно, через Nop2 и Rcm1. Наша работа раскрывает новую роль Trm112 в биогенезе рибосом и расширяет функцию Trm112 на все аспекты аппарата трансляции: две субъединицы рибосомы, тРНК и факторы трансляции.

РЕЗУЛЬТАТЫ

Bud23 и Trm112 взаимодействуют in vivo

Мы ранее идентифицировали Bud23 как метилтрансферазу, участвующую в биогенезе небольшой (40S) рибосомной субъединицы (White et al. , 2008). Чтобы дополнительно охарактеризовать функцию Bud23, мы провели тандемную аффинную очистку (TAP) для выявления взаимодействующих партнеров. В дополнение к известным факторам, связанным с 40S, мы идентифицировали Trm112 (неопубликованные данные). Это взаимодействие было интригующим, поскольку было показано, что Trm112 является «узловым» белком, который взаимодействует по крайней мере с тремя метилтрансферазами, влияя на различные аспекты трансляции, путем модификации тРНК и фактора трансляции (Mazauric et al., 2010; Liger et al. , 2011). Взаимодействие с Bud23 д. Вовлекать Trm112 также в биогенез рибосом. Мы подтвердили физическое взаимодействие между Bud23 и Trm112 двумя способами: коиммунопреципитацией и дрожжевым двугибридным анализом. Bud23 с С-концом, меченный TAP, экспрессировался в штамме, содержащем геномный Trm112, меченный зеленым флуоресцентным белком (GFP) с С-конца. Все экстракты подвергали иммунопреципитации против TAP-метки с использованием иммуноглобулина G (IgG) -сефарозы и анализировали на Trm112-GFP с помощью вестерн-блоттинга с использованием антитела против GFP.Rps8 использовали в качестве положительного контроля для очистки Bud23-TAP, поскольку Bud23 ассоциируется с частицами pre-40S. Trm112-GFP специфически иммунопреципитировали с помощью Bud23, меченного TAP ().

Bud23 и Trm112 взаимодействуют in vivo. (A) Bud23-TAP иммунопреципитирует Trm112-GFP. Экстракты из клеток, экспрессирующих Trm112-GFP (AJY3446) и Bud23-TAP (pAJ2558), подвергали иммунопреципитации с помощью IgG-сефарозы. Экстракты, полученные из клеток, экспрессирующих Trm112-GFP и немеченый Bud23, использовали в качестве отрицательного контроля. Иммунопреципитированные белки подвергали SDS-PAGE и вестерн-блоттингу с использованием антител против GFP-пероксидазы хрена и антител против Rps8 для обнаружения Trm112-GFP и Rps8 соответственно.(B) Штамм PJ69-4α, содержащий Trm112-Gal4BD (pAJ2895) и Gal4AD-Bud23 (pAJ2768), накладывали на планшеты Leu-Trp и Leu-Trp-His. Соответствующие контроли, содержащие соответствующие пустые векторы, также накладывали на планшеты для селекции, чтобы исключить возможность самоактивации репортера HIS3. Планшеты инкубировали при 30 ° C в течение 2 дней.

Для тестирования двухгибридного взаимодействия мы клонировали Trm112 с C-концевым слиянием ДНК-связывающего домена Gal4 в pGBKT7 и Bud23 с N-концевым слиянием домена активации Gal4 в pACT2.Мы наблюдали положительное двухгибридное взаимодействие между Bud23 и Trm112, о чем свидетельствует рост на среде без гистидина (). Таким образом, коиммунопреципитация и двухгибридный анализ дрожжей подтверждают результат масс-спектроскопии, согласно которому Bud23 и Trm112 взаимодействуют in vivo. Хотя мы не можем исключить возможность того, что их взаимодействие перекрывается третьим белком, известно, что Trm112 напрямую связывается с другими семью β-нитевыми метилтрансферазами. Таким образом, вероятно, что Bud23 напрямую связывает Trm112. Действительно, пока эта работа продолжалась, сообщалось о прямом комплексе Bud23 и Trm112 (Figaro et al., 2012).

Bud23 и Trm112 демонстрируют положительное генетическое взаимодействие

Белки, участвующие в одних и тех же или родственных путях, часто проявляют генетические взаимодействия. Чтобы проверить генетическое взаимодействие между Bud23 и Trm112, мы сравнили скорости роста одинарных мутантов bud23Δ и trm112Δ дикого типа и двойного мутанта bud23Δ trm112Δ дикого типа. Удаление BUD23 или TRM112 привело к серьезному дефекту роста (панели 1–3).Однако двойной мутант рос примерно с той же скоростью, что и отдельные одиночные мутанты (см. Панель 4). Количественные скорости роста определяли в жидких культурах. Пригодность рассчитывалась как время удвоения дикого типа, деленное на время удвоения мутанта. Если бы не было генетического взаимодействия, то можно было бы ожидать, что двойной мутант будет расти с приспособленностью, рассчитанной как произведение индивидуальных приспособлений одиночных мутантов (Dixon et al. , 2009). bud23Δ показал пригодность 0.30 по сравнению с диким типом, и trm112Δ имел приспособленность 0,27. При отсутствии генетического взаимодействия можно ожидать, что двойной мутант bud23Δ trm112Δ будет расти с приспособленностью 0,08 (0,30 × 0,27). Однако двойной мутант рос с приспособленностью 0,29, демонстрируя на 72% более высокую приспособленность, чем ожидалось, и указывает на сильное положительное генетическое взаимодействие ().

Bud23 и Trm112 показывают положительное генетическое взаимодействие. (A) Десятикратные серийные разведения изогенного дикого типа (BY4741), trm112Δ (AJY3517) и bud23Δ (AJY2161) одиночных мутантов, trm112Δ bud23Δ (AJY3524) двойного мутанта (utp -A2375G) и 53 bud (AJY3524) AJY3549) и trm112Δ utp14-A758G (AJY3547) мутанты помещали на полную богатую среду (YPD) и инкубировали при 30 ° C в течение 2 дней.(B) Количественное определение скорости роста мутантов, показанных на (A). Штаммы выращивали в 96-луночных планшетах в полностью обогащенной среде (YPD) при 30 ° C и непрерывно контролировали плотность в течение 36 часов. Пригодность каждого штамма рассчитывали путем деления времени удвоения изогенного штамма дикого типа на время удвоения мутанта. Ожидаемую приспособленность двойных мутантов к отсутствию генетического взаимодействия рассчитывали как произведение наблюдаемой приспособленности отдельных мутантов. (C) trm112Δ и bud23Δ мутанты демонстрируют аналогичную неправильную локализацию Utp14.Указанные штаммы, экспрессирующие геномный Utp14-GFP дикого типа или utp14-A758G -GFP, выращивали в синтетической полной среде до средней логарифмической фазы при 30 ° C и анализировали на флуоресценцию GFP. Ядра окрашивали 4 ‘, 6-диамидино-2-фенилиндолом (DAPI; здесь ложно окрашены в красный цвет).

Мы идентифицировали мутацию в UTP14 (A758G), кодирующую компонент процессома малой субъединицы в качестве экстрагенного супрессора дефекта роста bud23Δ (, панель 5; неопубликованные данные). Эта мутация в UTP14 также подавляла мутант trm112Δ (см. Панель 6 и).Более того, Utp14-GFP неправильно локализован из ядрышка в нуклеоплазму у мутанта trm112Δ аналогично тому, как это наблюдается у мутанта bud23Δ (; неопубликованные данные). Эта неправильная локализация может быть исправлена ​​как в мутанте bud23Δ , так и в мутанте trm112Δ с помощью супрессора utp14-A758G. Таким образом, мы заключаем, что Bud23 и Trm112 функционально взаимодействуют друг с другом и что мутанты дефектны для одной и той же стадии биогенеза 40S рибосом.

То, что bud23Δ и trm112Δ демонстрируют сильное положительное генетическое взаимодействие, и что серьезный дефект роста trm112Δ частично подавляется мутацией, которая подавляла bud23Δ , предполагает, что большая часть дефекта роста trm112Δ вызвана сбой в функции Bud23.Это довольно удивительно, учитывая, что Trm112 взаимодействует с множественными метилтрансферазами, участвующими во множестве аспектов трансляции.

Trm112 необходим для биогенеза 40S и 60S рибосом

Анализ профиля полисом с помощью центрифугирования в градиенте плотности сахарозы является чувствительным анализом для мониторинга биогенеза рибосом и дефектов трансляции. Мы использовали анализ полисом для анализа дефектов биогенеза рибосом в trm112Δ . Как сообщалось ранее, мутант bud23Δ обнаруживает сильный дефект биогенеза 40S, приводящий к сильному дисбалансу субъединиц с почти отсутствием свободных 40S, очень высокими уровнями свободных 60S и уменьшенным количеством полисом ().Мутант trm112Δ также обнаружил дефект биогенеза 40S; однако степень дисбаланса субъединиц была менее серьезной, чем у мутанта bud23Δ . Мы отмечаем, что дисбаланс субъединиц в этом штамме меньше, чем недавно сообщалось для trm112Δ (Figaro et al. , 2012). Однако мы наблюдали аналогичные профили от множественных клонов спор после спорулирования гетерозиготного диплоида trm112 (неопубликованные данные), предполагая, что этот профиль специфически отражает потерю TRM112 на фоне этого штамма.Мы также проанализировали trm112Δ , содержащий супрессор utp14-A758G. Неожиданно этот мутант обнаружил дефект биогенеза 60S, о чем свидетельствует обратный дисбаланс свободных субъединиц (уровни свободных 60S ниже, чем 40S) и полисомы полумеров. Полумеры содержат инициирующие комплексы 43S, к которым еще не присоединились субъединицы 60S, и которые являются обычным следствием снижения уровней 60S. Эти результаты предполагают, что Trm112 играет роль в путях биогенеза как 40S, так и 60S; однако дефект 40S более выражен, чем дефект биогенеза 60S у мутанта trm112Δ .

Trm112 необходим как для 40S, так и для 60S биогенеза. (A) trm112Δ мутант обнаруживает дефект биогенеза как малой, так и большой субъединицы. Экстракты целых клеток из контроля дикого типа (AJY2643), bud23Δ (AJY2161), trm112Δ (AJY3517), trm112Δ bud23Δ (AJY3524) и Y trm112Δ utp14-A758G (штамм Y trm112Δ utp14-A758G) были подвергнуты воздействию ультрацентрифугирование в градиенте плотности. Поглощение при 254 нм использовали для создания профилей полисом. Отмечено положение пиков и полумеров 40S, 60S и 80S.(B) trm112Δ мутант проявляет дефект процессинга как малой, так и большой субъединицы рРНК. Суммарная РНК, экстрагированная из указанных штаммов, выросших до OD 600 ∼ 0,3 в YPD при 30 ° C, была разделена на денатурирующем геле агароза / формальдегид, перенесена на мембрану и исследована гибридизацией с указанными олигонуклеотидными зондами для идентификации промежуточных продуктов процессинга рРНК. . Олигонуклеотидные зонды, используемые для Нозерн-блоттинга, перечислены в. (C) Количественное определение Нозерн-блотов, показанных на (B).Сигналы гибридизации детектировали с помощью фосфорного изображения и количественно оценивали с помощью Quantity One (Bio-Rad). Сигналы были нормализованы к U2 в качестве контроля загрузки, а числа указывают уровни по отношению к дикому типу (относительно WT).

Мы также сравнили эффект делеции TRM112 и BUD23 на процессинг рРНК. Bud23 необходим для эффективного расщепления по A2, которое дает промежуточное соединение 27SA2 (White et al. , 2008; неопубликованные данные). Действительно, оба мутанта сильно ингибировали расщепление А2.Оба мутанта также показали пониженные уровни зрелой 18S рРНК по сравнению с контролем дикого типа: bud23Δ продемонстрировал снижение на 61%, а trm112Δ — снижение на 56% 18S рРНК при нормализации до U2 (). Однако мы отметили, что мутант trm112Δ также демонстрировал снижение на 43% уровня 25S рРНК 60S субъединицы (и). Одновременное восстановление 18S и 25S рРНК в мутанте trm112Δ , вероятно, объясняет относительно нормальный баланс субъединиц, наблюдаемый в полисомном профиле мутанта trm112Δ ().Сходный дефект расщепления 27SA2 указывает на то, что Bud23 и Trm112 имеют общую функцию в расщеплении A2. Кроме того, сниженные уровни 25S и анализ профиля полисома позволяют предположить, что Trm112 также необходим для эффективной обработки 25S.

Седиментация Trm112 не зависит от Bud23

Из-за взаимодействия между Trm112 и Bud23 мы исследовали их седиментацию на градиентах сахарозы, чтобы определить, совмещаются ли они, что свидетельствует о стабильном комплексе in vivo.Экстракты получали из клеток, экспрессирующих TAP-меченый Trm112 и эписомально экспрессируемый Bud23, и подвергали центрифугированию в градиенте плотности сахарозы. Мы использовали две разные версии Bud23, помеченные как на N-, так и на C-конце. Trm112-TAP оседал в положении 60S, тогда как меченный на N-конце Bud23 находился преимущественно в положении 90S, перекрываясь с маркером 90S Mpp10 (вверху). Небольшое количество Trm112 также присутствовало в верхней части градиента. С другой стороны, Bud23, меченный С-концом, осаждается в положении 40S (, внизу).Недавняя работа с использованием антител против нативного комплекса Bud23-Trm112 показала, что оба белка совместно оседают в положении 80S / 90S, предполагая, что два белка существуют в стабильном комплексе (Figaro et al. , 2012). Хотя обе меченые версии Bud23 и Trm112-TAP, использованные в нашем исследовании, являются функциональными, природа метки и / или конца меченного белка оказывает сильное влияние на седиментацию белков. Тем не менее, тот факт, что обе меченые версии Bud23 были функциональными и ни одна из них не совмещалась с Trm112-TAP в наших экспериментах, демонстрирует, что эти два белка не всегда сосуществуют в стабильном комплексе, несмотря на то, что Trm112 необходим для стабильности Bud23 (см. ниже и позже в статье).

Осадки Trm112 и Bud23 с различными комплексами. Цельноклеточные экстракты обработанного циклогексимидом AJY3125, экспрессирующего геномный Trm112-TAP, и эписомальной двугибридной конструкции Bud23 (N-концевой GAL4BD-myc-меченый Bud23; вверху) или C-концевой GFP-меченный Bud23 (внизу) подвергали воздействию сахарозы. ультрацентрифугирование в градиенте плотности. Белки осаждали из фракций, подвергали SDS-PAGE, и меченный myc Bud23, меченный GFP Bud23, Rps8, Rpl8 и Mpp10 детектировали с использованием anti-myc, anti-GFP, anti-Rps8, anti-Rpl8 и anti -Mpp10 антитела соответственно.Trm112, меченный TAP, был обнаружен по его перекрестной реактивности с анти-Rps8 и анти-Rpl8, а также с антителами против Mpp10. Указаны положения 40S, 60S и 80S.

Trm112 влияет на стабильность in vivo некоторых, но не всех партнеров по взаимодействию. (A) Отсутствие Trm112 влияет на стабильность in vivo Bud23 и Mtq2, но не Nop2, Rcm1 или Trm11. Клетки дикого типа (AJY2643) или trm112Δ (AJY3517), экспрессирующие Bud23-13myc (pAJ2192), Nop2-13myc (pAJ2875), Rcm1-13myc (pAJ2878), Trm11-13myc (pAJ2876) или Mtq2-13myc) из плазмиды выращивали на селективных средах.Клетки, соответствующие 2,5 OD 600 единиц из лог-фазовых культур, собирали и подвергали щелочному лизису с последующим вестерн-блоттингом. Белки, меченные Myc, детектировали с использованием антител против myc. Глюкозо-6-фосфатдегидрогеназа (G6PDH) была обнаружена в качестве контроля с использованием антитела против G6PDH. (B) Сверхэкспрессия Trm112 стабилизирует Bud23 in vivo. Клетки дикого типа (AJY2643), экспрессирующие плазмидный Bud23-GFP (pAJ2151) и индуцибельный галактозой Trm112 (pAJ2583) или пустой вектор, выращивали в течение ночи в селективных средах, содержащих галактозу, при 30 ° C.Культуры разводили в селективных средах, содержащих галактозу, до OD 600 ∼ 0,1. Клетки из лог-фазовых культур, соответствующих 2,5 OD 600 единиц, собирали через 6 и 24 часа роста. Клетки лизировали щелочной обработкой, а белки определяли вестерн-блоттингом. Bud23-GFP, Trm112-zz и G6PDH детектировались антителами против GFP, пероксидаза-антипероксидаза (PAP) и анти-G6PDH соответственно.

Затем мы исследовали, зависело ли осаждение Trm112 от присутствия Bud23.Trm112 присутствует на вершине градиента и в области 60S, независимо от присутствия или отсутствия Bud23 (), указывая на то, что его седиментация не зависит от Bud23. Чтобы подтвердить, что Trm112-TAP действительно осаждается с 60S, мы затем запускали градиенты для Trm112-TAP в диссоциативных условиях и отслеживали осаждение Mpp10 в качестве маркера 90S, Nop2 в качестве маркера до 60S, Rpl10 в качестве маркера 60S и Rps8. как маркер 40S. В этих условиях Trm112 наиболее близко коседиментируется с Rpl10 и Nop2 в положении 60S, а не в положении 40S или 90S ().Чтобы подтвердить очевидную ассоциацию Trm112 с субъединицами пре-60S или 60S, мы провели анализ рРНК пре-60S, ассоциированных с Trm112. В соответствии с седиментационным анализом, Trm112-TAP эффективно сбрасывает 27S и 7S пре-рРНК, а также зрелую 25S рРНК, но не 20S пре-РНК или U3 snoRNA (). Относительное обогащение 27S и 7S было намного больше, чем 25S, что позволяет предположить, что Trm112 преимущественно связан с частицей до 60S. Ассоциация Trm112 с пре-60S или 60S субъединицами была подтверждена коиммунопреципитацией 60S белка Rpl8 ().Коиммунопреципитация рРНК пре-60S с Trm112 согласуется с седиментацией Trm112 в положении 60S и предполагает, что Trm112 преимущественно ассоциирован с видами до 60S.

Trm112-TAP преимущественно отложения с 60S. (A) На осаждение Trm112 не влияет присутствие или отсутствие Bud23. Экстракты целых клеток, полученные из обработанных циклогексимидом AJY3560 (Trm112-TAP дикого типа Bud23) и AJY3125 (Trm112-TAP bud23Δ ), подвергали ультрацентрифугированию в градиенте плотности сахарозы.Образцы подвергали SDS-PAGE и вестерн-блоттингу, как описано в. (B) Отложения Trm112 преимущественно при 60S в диссоциативных градиентах. Экстракт цельных клеток из AJY3560, экспрессирующего Nop2-13myc (pAJ2895) из плазмиды, получали в условиях диссоциации рибосомных субъединиц и фракционировали после ультрацентрифугирования в градиенте плотности сахарозы. Nop2-13myc и Rpl10 были обнаружены с использованием антител против myc и против Rpl10 соответственно. Все остальные белки были обнаружены, как описано в легенде к.

Trm112 иммунопреципитирует РНК пре-60S и ассоциированные метилтрансферазы. (A) Trm112-TAP иммунопреципитирует 60S-ассоциированные пре-рРНК. Экстракты из клеток, экспрессирующих Trm112-TAP (AJY3560), иммунопреципитировали с помощью IgG-сефарозы. Экстракт, полученный из клеток, экспрессирующих немеченый Trm112, использовали в качестве отрицательного контроля. Иммунопреципитированные РНК анализировали на наличие U3 snoRNA или специфических пре- и зрелых рРНК с помощью нозерн-блоттинга. Олигонуклеотидные зонды, используемые для Нозерн-блоттинга, перечислены в.(B) Trm112-TAP коиммунопреципитирует связанные с пре-60S метилтрансферазы, Nop2 и Rcm1. Экстракты из клеток, экспрессирующих геномный Trm112-TAP (AJY3560) и плазмидный Nop2-13myc (pAJ2875), Rcm1-13myc (pAJ2878) или пустой вектор, подвергали иммунопреципитации с помощью IgG-сефарозы. Иммунопреципитированные белки подвергали SDS-PAGE и вестерн-блоттингу с использованием антител против myc и против Rpl8 для обнаружения Nop2-13myc или Rcm1-13myc и Rpl8 соответственно.

Trm112 коиммунопреципитирует связанные с 60S метилтрансферазы Nop2 и Rcm1

Ассоциация Trm112 с субъединицами 60S и потребность в Trm112 для эффективного производства 60S (и) предполагает, что Trm112 имеет дополнительных партнеров в биогенезе 60S.Поскольку было показано, что Trm112 взаимодействует с множеством метилтрансфераз, мы решили проверить, взаимодействует ли Trm112 с дополнительными известными и не охарактеризованными метилтрансферазами, которые, как предполагается, играют роль в биогенезе 60S. Мы протестировали Rrp8, Ybr141c, Ylr063w, Nop2, Ybr271w, Rcm1 и Spb1 на взаимодействие с Trm112 путем коиммунопреципитации. Кандидаты в метилтрансферазы с С-концом, меченные myc, экспрессировали в штамме, содержащем геномный Trm112, меченный TAP на С-конце. Все экстракты подвергали иммунопреципитации против TAP-метки с использованием IgG-сефарозы и анализировали на myc-меченые белки с помощью вестерн-блоттинга.Trm112-TAP специфически иммунопреципитировал две 60S-родственные метилтрансферазы, Nop2 и Rcm1 (). Таким образом, анализ коиммунопреципитации показывает, что Trm112 специфически взаимодействует с Nop2 и Rcm1 in vivo.

Trm112 влияет на стабильность in vivo некоторых, но не всех, своих партнеров по взаимодействию

Предыдущая работа показала, что взаимодействие с Trm112 солюбилизирует Mtq2 и Trm9 в экстрактах Escherichia coli (Heurgue-Hamard et al. , 2006 ; Чен и др., 2011). Чтобы проверить влияние Trm112 на уровни Bud23, Nop2 и Rcm1 in vivo, мы изучили стационарные уровни этих белков в клетках дикого типа и мутантных клетках trm112Δ . Мы также рассмотрели уровни Mtq2 и Trm11 в качестве контроля для белков, которые ранее были охарактеризованы как партнеры по взаимодействию с Trm112. Наши результаты показывают, что отсутствие Trm112 оказывает драматическое влияние на стабильность in vivo некоторых, но не всех его партнеров по взаимодействию (). В частности, мы наблюдали, что Bud23 и Mtq2 были сильно восстановлены в мутанте trm112Δ .Однако уровни Nop2, Rcm1 и Trm11 были умеренно или совсем не затронуты отсутствием Trm112. Для дальнейшего изучения влияния уровней Trm112 на стационарные уровни Bud23 мы исследовали Bud23-GFP в штамме, экспрессирующем Trm112 под контролем индуцируемого галактозой промотора на плазмиде. Затем мы сравнили уровни Bud23-GFP в присутствии или в отсутствие сверхэкспрессированного Trm112 (). В отсутствие сверхэкспрессии TRM112 уровни Bud23 в насыщенных культурах были существенно снижены (сравните дорожки 2 и 1).Это ожидается для большинства факторов, участвующих в биогенезе рибосом. Однако сверхэкспрессия Trm112 приводила к повышенным уровням Bud23-GFP в растущих и насыщенных культурах (сравните дорожки 3 и 1 и дорожки 4 и 2), предполагая, что уровни Bud23 в клетках частично зависят от уровня Trm112.

Специфические мутации в Bud23 приводят к потере взаимодействия Trm112-Bud23

Мы мутировали кластеры открытых остатков на Bud23 и тестировали на потерю взаимодействия с Trm112 с помощью двухгибридного анализа, как описано в.Мутант bud23-RSD (R107L, S110A, D112G) привел к полной потере детектируемого взаимодействия (). Мы смоделировали предсказанную структуру домена метилтрансферазы Bud23 (White et al. , 2008) на недавно описанной кристаллической структуре Mtq2-Trm112 (Liger et al. , 2011;). Хотя только R107 находится на интерфейсе в смоделированной структуре, петля Trm112 (aa 32–35) не разрешается в структуре Mtq2-Trm112 и, таким образом, может взаимодействовать с дополнительными остатками Bud23.Утрата двухгибридного взаимодействия не объяснялась потерей мутантного белка Bud23, поскольку уровни мутантного белка Bud23-RSD были лишь незначительно снижены по сравнению с белком дикого типа (). Однако двугибридная конструкция была вектором с высокой копией и сверхэкспрессировала Bud23. Следовательно, мы переключили мутант bud23-RSD на вектор с низкой копией, чтобы более точно воспроизвести эндогенную экспрессию Bud23, и исследовали его способность комплементировать мутант bud23Δ . В этом анализе мутант bud23-RSD оказался полностью нефункциональным ().Кроме того, мы наблюдали серьезное снижение уровня мутантного белка при экспрессии из низкокопийного вектора (), что было аналогично тому, которое наблюдалось для Bud23 дикого типа в мутанте trm112Δ (). Таким образом, мы заключаем, что специфическое взаимодействие с Trm112 является критическим для стабильности и, следовательно, функции Bud23 in vivo.

Взаимодействие Bud23-Trm112 является биологически значимым. (A) Специфические мутации в Bud23 приводят к потере двугибридного взаимодействия Bud23-Trm112. Штамм PJ69-4α, содержащий мутант Trm112-Gal4BD (pAJ2895) и Gal4AD-Bud23 (pAJ2768) или Gal4AD-Bud23-RSD (pAJ2907) на плазмидах, накладывали на планшеты Leu-Trp и Leu-Trp-His.Соответствующие элементы управления (описанные в) также были исправлены параллельно. Планшеты инкубировали при 30 ° C в течение 2 дней. (B) Смоделированная Bud23 структура (aa 1-219) вручную стыкована с недавней структурой Encephalitozoon cuniculi Trm112-Mtq2 (PDB 3Q87). Trm112 — пурпурный, Bud23 — голубой, SAM — оранжевый, мутантные остатки в Bud23 (R107, S110 и D112) обозначены пунктирными сферами зеленого цвета. (C) Потеря двухгибридного взаимодействия не объясняется потерей уровня белка. Штамм PJ69-4α, содержащий Trm112-Gal4BD (pAJ2895) и Gal4AD-Bud23 (pAJ2768) или Gal4AD-Bud23-RSD (pAJ2907) на 2 мкг (высококопийных) плазмидах, используемых в, выращивали в среде Leu-Trp.Клетки, соответствующие 2,5 OD 600 единиц из лог-фазовых культур, подвергали щелочному лизису. Белки разделяли с помощью SDS-PAGE и подвергали вестерн-блоттингу. Gal4AD-гемагглютинин-Bud23 и Trm112-Gal4BD-myc были обнаружены антителами против гемагглютинина (HA) и против myc соответственно. (D) Неспособность взаимодействовать с Trm112 приводит к потере биологической активности Bud23. Мутант bud23Δ (AJY2161), содержащий пустой вектор, мутант Bud23 дикого типа (pAJ2154) или мутант Bud23-RSD (pAJ2798) анализировали на функцию путем комплементации роста.Десятикратные серийные разведения нормализованных лог-фазовых культур наносили на синтетические среды без лейцина. Планшеты инкубировали при 30 ° C в течение 2 дней. (E) Неспособность взаимодействовать с Trm112 приводит к снижению стабильности Bud23 in vivo. bud23Δ мутант (AJY2161), содержащий N-концевой myc-меченный Bud23 дикого типа (pAJ2892) или мутант Bud23-RSD (pAJ2894), на низкокопийных плазмидах выращивали в селективных средах без лейцина. Клетки, соответствующие 2,5 OD 600 единиц из лог-фазовых культур, подвергали щелочному лизису.Белки разделяли с помощью SDS-PAGE и подвергали вестерн-блоттингу. myc-Bud23 был обнаружен антителами против myc. G6PDH детектировали с использованием антитела против G6PDH в качестве контроля нагрузки.

ОБСУЖДЕНИЕ

Дрожжи Trm112 — это небольшой белок цинкового пальца массой 15 кДа, который, как было показано, связывается и регулирует каталитическую активность и стабильность нескольких метилтрансфераз, участвующих в различных аспектах трансляции (Purushothaman et al. , 2005; Heurgue -Hamard и др. , 2006 г .; Mazauric и др., 2010; Liger et al. , 2011). К ним относятся Trm9 и Trm11, которые отвечают за метилирование тРНК (Purushothaman et al. , 2005; Mazauric et al. , 2010), и Mtq2, который отвечает за метилирование фактора терминации трансляции eRF1 (Heurgue- Hamard и др. , 2006; Лигер и др. , 2011). Наша работа расширяет функцию Trm112 до биогенеза обеих субъединиц рибосом посредством его взаимодействия с малой субъединицей метилтрансферазой Bud23 и, вероятно, через Nop2 и Rcm1, действующие на большую субъединицу.В ходе этой работы о подобной функции Trm112 в функции Bud23 сообщили Figaro et al. (2012).

Как Trm112 влияет на функцию своих партнеров метилтрансферазы?

Ранее было показано, что Trm112 необходим для растворимости Mtq2 и Trm9 (Heurgue-Hamard et al. , 2006; Mazauric et al. , 2010). В этом исследовании мы показываем, что Trm112 необходим для стабильности Bud23 in vivo. Несмотря на то, что Bud23 необходим для высококонсервативного метилирования G1575 в 18S рРНК, для биогенеза рибосом и нормального клеточного роста важен белок, а не его метилтрансферазная активность как таковая (White et al., 2008 г .; Фигаро и др. , 2012). Уровни Bud23 практически не обнаруживаются в отсутствие Trm112 и повышаются за счет сверхэкспрессии Trm112. Фигаро и др. (2012) продемонстрировал аналогичные результаты и расширил эту работу, продемонстрировав, что два белка образуют стабильный комплекс in vitro и совмещаются с градиентами плотности сахарозы в положении 90S прерибосомной частицы. Мы исследовали седиментационное поведение Trm112 и Bud23, используя меченые версии белков.Мы воспользовались тем фактом, что метки по-разному влияют на осаждение Bud23; Bud23, содержащий GAL4-связывающий домен, слитый с N-концом, оседает на 90S, тогда как он осаждается на 40S с GFP, слитым с C-концом. Оба слитых белка функционируют in vivo. Таким образом, мы могли использовать эти меченые Bud23 белки, чтобы исследовать зависимость седиментации Trm112 от Bud23. Мы обнаружили, что меченые Bud23 и Trm112 не совмещаются, и что на седиментацию Trm112 не влияет присутствие или отсутствие Bud23.Эти результаты показывают, что Trm112 и Bud23 не поддерживаются в стабильном комплексе, несмотря на тот факт, что стабильность Bud23 зависит от присутствия Trm112. Вместе эти результаты подтверждают, что временное взаимодействие между Bud23 и Trm112 достаточно для стабильности Bud23. Это можно объяснить, если Trm112 стабилизирует свободный Bud23, который не взаимодействует с субстратом. Trm112 также может играть важную роль в доставке Bud23 к его субстрату. Сообщается, что Trm112 экспрессируется в количестве 4800 молекул на клетку, тогда как Mtq2, Bud23, Trm9 и Trm11 вместе взятые составляют 8900 молекул на клетку (Ghaemmaghami et al., 2003). Это помимо дополнительных взаимодействий Trm112 с Dhr1 (Krogan и др. , 2006), Lys9 (Mazauric и др. , 2010), Sfh2 (Yu и др. , 2008) и Nop2 и Rcm1, идентифицированных здесь. . Таким образом, кажется маловероятным, что в клетке имеется достаточно Trm112 для одновременного связывания всех ее партнеров, что согласуется с выводом, что Trm112 не остается в стабильном комплексе с Bud23. Это может быть общим свойством того, как Trm112 взаимодействует со своими партнерами-метилтрансферазами в клеточном контексте.

Trm112 взаимодействует с множеством метилтрансфераз, участвующих в различных аспектах функции рибосом. Однако мутанты trm112Δ и bud23Δ демонстрируют сильное положительное генетическое взаимодействие: двойной мутант растет практически с той же скоростью, что и отдельные одиночные мутанты. Это согласуется с почти полной потерей Bud23 из клеток, лишенных Trm112; если Bud23 нестабилен в мутанте trm112Δ , не ожидается, что делеция BUD23 ухудшит фенотип.Мы смоделировали предсказанную структуру Bud23 (White et al. , 2008; Figaro et al. , 2012) на недавней кристаллической структуре Mtq2-Trm112 (Liger et al. , 2011). Затем мы мутировали группы соседних открытых остатков и проверили потерю взаимодействия. Мутация кластера остатков R107, S110, D112 приводила к потере взаимодействия с Trm112 и потере функции Bud23. Хотя мутантный белок экспрессировался на уровнях, близких к уровням дикого типа при сверхэкспрессии в двугибридной конструкции, белок не обнаруживался при экспрессии из низкокопийного центромерного вектора, что согласуется с нашим выводом о том, что взаимодействие Trm112 необходимо для поддержания Bud23. .Интересно, что Фигаро и др. (2012) отметили, что мутант rid2-1 в гомологе Arabidopsis Bud23 соответствует положению R107. rid2-1 является мутантом с частичной потерей функции, который обнаруживает дефекты процессинга рРНК, согласующиеся с дефектом Bud23-подобной функции (Ohbayashi et al. , 2011). Поскольку R107 находится в кластере остатков, влияющих на взаимодействие Bud23 с Trm112 в дрожжах, вполне вероятно, что мутант rid2-1 специфически дефектен для взаимодействия с гомологом Arabidopsis Trm112.

Расширение функции Trm112 на биогенез обеих субъединиц рибосомы

Тот факт, что мы могли частично подавить дефект роста мутанта trm112Δ с помощью мутации utp14, которую мы идентифицировали как супрессор bud23Δ , предполагает, что значительный компонент дефекта роста мутанта trm112Δ происходит из-за потери Bud23. Специфическая функция UTP14 в биогенезе рибосом неизвестна, и мы в настоящее время изучаем механизм того, как utp14-A758G подавляет мутант bud23Δ .Интересно, что подавление trm112Δ с помощью мутации utp14 выявило лежащий в основе дефект биогенеза 60S, который также проявлялся в недостаточной аккумуляции 25S рРНК в одном только мутанте trm112Δ . Эти результаты показывают, что Trm112 играет роль в биогенезе 60S помимо своей роли в биогенезе 40S посредством Bud23. Мы обнаружили, что Trm112-TAP осаждается в основном в положении 60S, а не 90S или до 40S. Это согласуется с тем, что Trm112 играет роль в биогенезе 60S и его взаимодействии с Nop2 и Rcm1 (сообщается здесь) и дополнительными факторами 60S (сообщается Figaro et al ., 2012). В самом деле, обогащение pre-60S 27S и 7S РНК с помощью Trm112 строго подтверждает роль Trm112 в биогенезе 60S. Однако седиментация Trm112-TAP при 60S отличается от того, что сообщалось для нативного Trm112, который оседал при 90S (Figaro et al. , 2012). Хотя в наших экспериментах мы использовали Trm112 с меткой TAP, эта версия Trm112 с меткой демонстрирует рост дикого типа (неопубликованные данные; Figaro et al. , 2012). Таким образом, седиментация при 60S предполагает стабильное взаимодействие с фактором, связанным с 60S.Поскольку Trm112 является известным партнером SAM-зависимых метилтрансфераз или белков, содержащих складку метилтрансферазы, мы искали взаимодействие между Trm112 и известными и предполагаемыми метилтрансферазами, участвующими в биогенезе 60S посредством коиммунопреципитации. Мы обнаружили, что Nop2 и Rcm1 являются положительными попаданиями для взаимодействия с Trm112. Интересно, что Nop2 был также идентифицирован при недавней очистке Trm112-TAP (Figaro et al. , 2012). Nop2 — это ядрышковый белок, необходимый для процессинга 27S пре-рРНК в биогенезе 60S (Hong et al., 2001). Было высказано предположение, что это м5С-метилтрансфераза рРНК (Pavlopoulou and Kossida, 2009; Petrossian and Clarke, 2009), но ее активность и сайт модификации не охарактеризованы (Reid et al., 1999; Hong et al. , 2001). Rcm1 (YNL022C), как полагают, также является рРНК m5C-метилтрансферазой, тесно связанной с Nop2 (Pavlopoulou and Kossida, 2009). Однако, как и у Nop2, его субстрат неизвестен. Таким образом, представляет интерес идентифицировать субстраты для этих предполагаемых метилтрансфераз, чтобы определить, требуется ли Trm112 для их активности метилирования, как недавно было продемонстрировано для катализируемого Bud23 метилирования в положении G1575 в 18S рРНК (White et al., 2008 г .; Фигаро и др. , 2012).

МАТЕРИАЛЫ И МЕТОДЫ

Штаммы, плазмиды и среды

Все штаммы дрожжей, использованные в этом исследовании, перечислены в. Штаммы, меченные Trm112-TAP и Utp14-GFP, были получены от Open Biosystems (Lafayette, CO; Ghaemmaghami et al. , 2003; Huh et al. , 2003). AJY3517 ( trm112Δ :: G418r ) был получен путем споруляции и рассечения TRM112 / гетерозиготного диплоидного штамма trm112Δ от Open Biosystems (Winzeler et al., 1999). AJY3524, AJY3549, AJY3547, AJY3538 и AJY3541 были созданы путем скрещивания соответствующих родительских штаммов, спорулированы путем внесения заплат на среду для споруляции в течение 5-7 дней при комнатной температуре и препарированы на среде дрожжевой пептон-декстроза (YPD). Все штаммы были подтверждены ростом на селекционной среде и ПЦР для делеции или метки конкретного гена.

ТАБЛИЦА 1:

Штаммы, использованные в этом исследовании.

Клетки культивировали при 30 ° C, если не указано иное, в богатой среде или синтетической среде отсева, содержащей 2% глюкозы.Все микробиологические методы и клонирование выполняли, как описано ранее (Sambrook et al ., 1989). Для количественной оценки генетического взаимодействия Trm112-Bud23 клетки культивировали в 100 мкл YPD, содержащего 75 мкг / мл ампициллина, в 96-луночных планшетах путем непрерывного встряхивания в течение 36 часов в считывающем устройстве для микропланшетов Powerwave (Biotek, Winooski, VT). Время удвоения рассчитывали по кривым роста, как описано ранее (Toussaint and Conconi, 2006).

Все плазмиды и олигонуклеотиды, использованные в этом исследовании, перечислены в и, соответственно.Подробная информация о конструкции плазмиды предоставляется по запросу.

ТАБЛИЦА 2:

Плазмиды, использованные в этом исследовании.

57 ARS 57 ARS CEN ARS 77 77 Это исследование Настоящее исследование
pAJ Описание Источник
2558 BUD23-TAP LEU2 CEN ARS Это исследование
-RU
-RU LEU49 Это исследование
2895 TRM112-GAL4BD-cmyc TRP1 2 μ Это исследование
2768 GAL4AD-HA-BUD23 LEU2 2 μ Это исследование Gal4AD-HA-bud23-RSD LEU2 2 μ Настоящее исследование
2351 pGBKT7 TRP1 2 μ Louvet et al., 1997
2144 pACT2 LEU2 2 μ Clontech
2192 BUD23-13myc LEU2 CEN ARS CEN ARS Это исследование
2878 RCM1-13myc LEU2 CEN ARS Это исследование
2876 TRM11-13myc LEU2
MTQ2-13myc LEU2 CEN ARS Это исследование
2583 pGAL1-TRM112-zz-6XHIS URA3 Гельперин и соавт., 2005
2154 BUD23 LEU2 CEN ARS Белый и др. ., 2008
2798 BUD23-RSD LEU2 CEN ARS 2800000 CEN ARS
RRP8-13myc URA3 CEN ARS Это исследование
2873 YBR141C-13myc URA3 CEN ARS Это исследование
2814143 CENBY
2814143 CENBY
2879 YBR271W-13myc URA3 CEN ARS Это исследование
2890 SPB1-13myc URA3 CEN ARS 14D 149 myc-BUD23 LEU2 CEN ARS Это исследование
2894 GAL4BD-myc-BUD23-RSD LEU2 CEN ARS Это исследование

ТАБЛИЦА 3:

Олиго, использованные в этом исследовании.

AJO Задача Последовательность
603 35S TGTTACCTCTGGGCCCCGATTG
603 27SA2 TGTTACCTCTGGGCCCCGATTG
282 27S, 7S GGCCAGCAATTTCAAGTTA
130 20S TCTTGCCCAGTAAAAGCTCTCATGC
190 18S GTCTGGACCTGGTGAGTTTCCC
192 25S CCCGCCGTTTACCCGCGCTTGG
603 23S TGTTACCTCTGGGCCCCGATTG
962 U2 GCGACCAAAGTAAAAGTCAAGAACGACTCCACAAGTGCGAGGGTCGCGAC
1686 U3 TAGATTCAATTTCGGTTTCTC
915 52 Анализ двух гибридных взаимодействий плазмиды ивационного домена (AD) и связывающего домена (BD) (Louvet et al., 1997) трансформировали в PJ69-4α (James et al. , 1996) и отбирали на средах для выпадения, не содержащих лейцин и триптофан. Затем трансформанты накладывали на среду для выпадения, в которой отсутствовали лейцин, триптофан и гистидин, для тестирования двухгибридного взаимодействия.

Иммунопреципитация и вестерн-блоттинг

Для иммунопреципитации культуры выращивали до OD 600 0,6–0,8 в селективной среде. Клетки ресуспендировали в IP-буфере (100 мМ NaCl, 50 мМ Трис-HCl, pH 7.5, 1,5 мМ MgCl 2 , 0,15% NP40, 1 мМ фенилметилсульфонилфторид (ФМСФ), 1 мкг / мл лейпептина, 1 мкг / мл пепстатина A), лизированный встряхиванием со стеклянными шариками и осветленный центрифугированием при 15000 × g при 4 ° C. Иммунопреципитация была выполнена для метки протеина А путем инкубации экстрактов с гранулами IgG-сефарозы (IgG Sepharose 6 Fast Flow; Amersham, Pittsburgh, PA) в течение 1 часа при 4 ° C; за этим следовало расщепление ферментом протеазой вируса травления табака (TEV) при 16 ° C в течение 2 часов. Гранулы отделяли от элюата TEV центрифугированием при 2000 × g в течение 30 с.Элюированные белки осаждали добавлением 10% TCA. Для Нозерн-блоттинга иммунопреципитированных образцов элюаты TEV подвергали экстракции кислым фенолом: хлороформом, как описано ранее (Sambrook et al ., 1989). РНК в водной фазе осаждали 2,5 об. Этанола и 0,1 об. Ацетата натрия (pH 5) при -20 ° C в течение 24 часов. Белки в органической фазе осаждали 2 об. Ацетона при -20 ° C в течение 24 часов.

Для вестерн-блоттинга мембраны инкубировали с соответствующим первичным антителом в течение 2 часов при комнатной температуре или в течение ночи при 4 ° C и с вторичным антителом в течение 30 минут при комнатной температуре.

Микроскопия

Ночные культуры разбавляли до OD 600 0,1 в свежей селективной среде и позволяли расти в течение 4–5 часов при 30 ° C. Флуоресценцию визуализировали на микроскопе Nikon (Мелвилл, штат Нью-Йорк) E800, оснащенном объективом Plan Apo 100 × / 1,4 и камерой Photometrics CoolSNAP ES (Тусон, Аризона), управляемой программным обеспечением NIS-Elements AR версии 2.10. Изображения были подготовлены с помощью Adobe Photoshop CS5 (Сан-Хосе, Калифорния).

Седиментация в градиенте плотности сахарозы

Для анализа профиля полисома клетки выращивали при 30 ° C до OD 600 , равного 0.3. К культурам добавляли циклогексимид (100 мкг / мл); после этого инкубировали в шейкере 30 ° C в течение 10 мин. Затем клетки немедленно выливали на лед и собирали центрифугированием. Все этапы проводились при 0–4 ° C. Клетки промывали буфером для лизиса (100 мМ KCl, 50 мМ трис-HCl, pH 7,5, 5 мМ MgCl 2 , 150 мкг / мл циклогексимида, 7 мМ бета-меркаптоэтанол [BME], 1 мМ PMSF, 1 мкг / мл. лейпептин, 1 мкг / мл пепстатина A) и лизировали встряхиванием в присутствии стеклянных шариков. Для диссоциативных градиентов клетки не обрабатывали циклогексимидом перед сбором, а экстракты готовили в буфере для лизиса без циклогексимида и магния.Экстракты центрифугировали в течение 10 минут при 15000 × g при 4 ° C, и 9 OD 260 единиц осветленного экстракта загружали в градиенты 7–47% сахарозы, приготовленные в соответствующем буфере, и центрифугировали в течение 2,5 часов при 40000 об / мин ( Ротор SW40; Бекман). Градиенты фракционировали (модель 640; ISCO, Lincoln, NE) при непрерывном мониторинге при 254 нм. Фракции осаждали 10% TCA в течение ночи при -20 ° C. Осадки ресуспендировали в буфере Лэммли и кипятили при 99 ° C в течение 5 минут. Белки разделяли на 8% SDS-PAGE гелях, переносили на нитроцеллюлозную мембрану и подвергали вестерн-блоттингу.

Нозерн-блоттинг

Все РНК получали с использованием экстракции кислый фенол: хлороформ, как описано ранее (Sambrook et al ., 1989). РНК разделяли электрофорезом в 1% агарозоформальдегидном геле и переносили на мембрану Zeta-Probe GT (Bio-Rad, Hercules, CA) капиллярным переносом. Перенесенные РНК подвергали УФ-поперечному связыванию с мембраной, и Нозерн-блоттинг с использованием 5 ‘- [ 32 P] -меченных олигонуклеотидных зондов выполняли, как описано ранее (Li et al., 2009 г.). Сигналы гибридизации детектировали с помощью фосфорного изображения и количественно оценивали с помощью Quantity One (Bio-Rad).

sls-детектор · PyPI

Библиотека Python для детектора sls. Он используется в АЛЬБА — BL04 MSPD канал для управления детектором SLS Mythen II.

Он построен как преемник долгоживущей C ++ slsDetectorLibrary.

Должно быть довольно легко поддерживать другие детекторы SLS. семья.

Библиотека обеспечивает полное дистанционное управление детектором Mythen II, довольно полный симулятор и Лима плагин камеры с классом устройств танго.Также есть экспериментальная Сардана. 1D контроллер, который в настоящее время не используется ( Контроллер Sardana Lima 2D вместо этого используется).

Также предоставляется простой графический интерфейс на основе PyQt5 и pyqtgraph. Это предназначен только для тестовых целей.

Установка

Из вашей любимой среды Python введите в командной строке:

$ pip install sls-детектор

Библиотека

Библиотека может использоваться с:

 от слс.детектор импорта клиентов
из sls.protocol import RunStatus


mythen = Детектор ('bl04mythen')

печать (mythen.energy_threshold)

assert mythen.run_status == RunStatus.IDLE

mythen.dynamic_range = 32

с mythen.acquisition (exc_time = 0.1, nb_frames = 10) как acq:
    для event_type данные в mythen.acquisition ():
        если event_type == 'frame':
            печать (данные)
 

(больше примеров в каталоге examples /)

Симулятор

Перед использованием симулятора убедитесь, что все зависимости установлены с:

$ pip install sls-Detector [симулятор]

Напишите простой файл конфигурации TOML, описывающий извещатели, которые вы хочу разоблачить.Пример:

 # mythen.toml

[bl04mythen1]
ctrl_port = 1952
stop_port = 1953
 

Запустите симулятор с:

 $ sls-simulator --log-level = ОТЛАДКА -c mythen.toml
ИНФОРМАЦИЯ 2020-05-15 08: 46: 02,531 root: подготовка к запуску ...
ИНФОРМАЦИЯ 2020-05-15 08: 46: 02,533 SLSServer.Detector (bl04mythen1): готов принимать запросы
 

Теперь вы сможете получить доступ к симулятору точно так же, как к настоящему детектору:

 из детектора импорта sls.client


mythen = Детектор ('локальный хост')

печать (mythen.energy_threshold)
 

Лима

Перед использованием lima убедитесь, что lima правильно установлена.

Из командной строки

 $ sls-lima --host = bl04mythen -n 10 -e 0.25 -d / tmp / mythen --saving-format = EDF --saving-prefix = миф_
Готово последнее изображение = 10/10
Взял 2.5158393383026123с
 

Как библиотека

 из детектора импорта sls.client
из sls.lima.camera import get_ctrl
из Lima.Core импорт AcqRunning

ctrl = get_ctrl ('bl04mythen') # Лима.Core.CtControl
acq = ctrl.acquisition ()
acq.setAcqExpoTime (0,1)
acq.setAcqNbFrames (10)
ctrl.prepareAcq ()
ctrl.startAcq ()
а ctrl.getStatus (). AcquisitionStatus == AcqRunning:
    print ('Выполняется ... Жду завершения!')
    time.sleep (0,1)
print ('Готово!')
 

Как сервер Лимского танго

Сначала зарегистрируйте сервер Lima Mythen Tango.

Устройство LimaCCDs должно иметь свойство LimaCameraType , установленное на MythenSLS

Вы можете запустить сервер устройств Lima tango с помощью скрипта LimaCCDs или с помощью:

 $ sls-lima-tango-server <название экземпляра lima tango>
 

графический интерфейс

Предоставляется простой графический интерфейс Qt.Пока он предназначен только для тестовых целей.

Перед запуском убедитесь, что он правильно установлен с:

$ pip install sls-Detector [графический интерфейс]

Запустить с:

$ sls-gui --host = bl04mythen

Вот и все, ребята!

Трансформированные Agrobacterium растения риса, экспрессирующие синтетические гены cryIA (b) и cryIA (c), высокотоксичны для полосатого стеблевого мотылька и желтого стеблевого мотылька

Abstract

Более 2600 трансгенных растений риса девяти штаммов были регенерированы из> 500 независимо отобранных устойчивых к гигромицину каллусов после трансформации, опосредованной Agrobacterium .Растения трансформировали полностью модифицированными (оптимизированными по кодонам растений) версиями двух синтетических кодирующих последовательностей cryIA (b) и cryIA (c) из Bacillus thuringiensis , а также генов hph и gus , кодирующих для гигромицинфосфотрансферазы и β-глюкуронидазы соответственно. Эти последовательности были помещены под контроль промотора кукурузы убиквитина , промотора CaMV35S и промотора гена Brassica Bp10 для достижения высокой и тканеспецифичной экспрессии дельта-эндотоксинов, специфичных для чешуекрылых.Интеграция, экспрессия и наследование этих генов были продемонстрированы в поколениях R 0 и R 1 южным, северным и западным анализами и другими методами. Накопление высоких уровней (до 3% растворимых белков) белков CryIA (b) и CryIA (c) было обнаружено в растениях R 0 . Биотесты с трансгенными растениями R 1 показали, что трансгенные растения были высокотоксичны для двух основных насекомых-вредителей риса, полосатого мотылька ( Chilo suppressalis ) и желтого стеблевого мотылька ( Scirpophaga incertulas ) со смертностью 97–100%. в течение 5 дней после заражения, что дает потенциал для эффективной устойчивости трансгенных растений риса к насекомым.

Рис — одна из важнейших продовольственных культур в мире, и необходимо прилагать активные усилия, включая использование технологий генной инженерии, для увеличения его урожайности, чтобы избежать надвигающейся глобальной нехватки риса (1). Создание риса для устойчивости к вредителям является серьезной проблемой, одна из стратегий заключается во введении Bacillus thuringiensis ( Bt ) генов кристаллического инсектицидного белка (δ-эндотоксина) ( cry гена). Эти белки ( токсинов Bt ) очень токсичны для чешуекрылых, двукрылых и жесткокрылых насекомых (2), среди которых есть важные вредители риса, такие как полосатый мотылек (SSB), желтостебельный мотылек (YSB) и листопад (). Cnaphalocrocis medinalis и Marasmia patnalis ), которые вызывают ежегодные потери примерно в 10 миллионов тонн (3).

Растения риса, содержащие cryIA (b) или cryIA (c) , были получены с использованием методов протопластов (4) или бомбардировки частицами (5-7). Однако количество полученных растений и уровни токсиновых белков в этих исследованиях, к сожалению, все еще были очень низкими с точки зрения селекционеров. Напротив, более 2600 трансгенных растений были получены с модифицированными генами cry в девяти штаммах риса с использованием модифицированной процедуры трансформации риса на основе Agrobacterium (8).Здесь мы сообщаем, что среди этих трансгенных растений были обнаружены высокие уровни CryIA (b) и CryIA (c), что указывает на то, что многие трансгенные растения-кандидаты в этом большом скрининге могут быть результатом эффектов оптимального положения. Анализы питания насекомых тканями растений R 1 показали, что трансгенные растения были высокотоксичными для двух основных рисовых насекомых, SSB и YSB, с почти 100% смертностью в течение 5 дней. Это указывает на то, что технология трансформации Agrobacterium действительно может оказаться очень эффективной для улучшения риса с важными агрономическими характеристиками.

МАТЕРИАЛЫ И МЕТОДЫ

Векторы трансформации.

Все четыре вектора, использованные для трансформации риса, были основаны на бинарном векторе pKHG4, производном от pBin19 (9). Последовательности, кодирующие инсектицидные белки CryIA (b) и CryIA (c) из B. thuringiensis , были повторно синтезированы химическим путем с оптимизированным использованием кодонов для растений (10). Последовательности были помещены под контроль промотора убиквитина кукурузы (11), промотора CaMV35S (12), пыльцевого промотора (промотор гена Bp10 ) (13) и терминатора nos .Эти химерные гены [ Ubi-cryIA (b) , 4,1 т.п.н .; Ubi-cryIA (c) , 4,1 кб; 35S- cryIA (b) , 2,9 т.п.н .; и Bp-cryIA (b) , 2,6 т.п.н.] были вставлены в сайт Hin dIII в pKHG4 как фрагменты Hin dIII, в результате чего были получены четыре вектора гена Bt , pKUB, pKUC, pKSB и pKBB соответственно ( Рисунок 1).

Рисунок 1

Т-ДНК pKUB, pKUC, pKSB и pKBB. Эти векторы были сконструированы путем вставки различных генов Bt в уникальный сайт Hin dIII в бинарном векторе pKHG4.Последовательность за пределами границы идентична pBin19. BR, граница правая; BL, левая граница; HPH, гигромицинфосфотрансфераза; NPTII, неомицинфосфотрансфераза; CryIA (b) и CryIA (c), гены синтетических инсектицидных белков из B. thuringiensis ; P35S, промотор CaMV 35S; Pubi, промотор убиквитина кукурузы; Pnos, промотор нопалинсинтазы; Pbp, Bp10 промотор гена пыльцы; NT, 3′-терминатор нопалинсинтазы.

Трансформация риса.

Метод трансформации (8), модифицированный Хиеи и соавторами (14), был использован для трансформации каллуса из зрелых или незрелых (Nipponbare) зародышей девяти штаммов риса (таблица 1). Agrobacterium LBA4404 (15) и EHA105 (16) использовали для трансформации активно растущих каллусов риса (возрастом от 1 до 4 месяцев).

Таблица 1

Получение устойчивых к гигромицину каллусов и растений из каллусов риса, инокулированных A. tumefaciens

Анализ активности β-глюкуронидазы (GUS).

Экспрессия гена gus была проанализирована после улучшенной процедуры гистохимического окрашивания (17).

Анализ белков CryIA (b) и CryIA (c).

Измельченные образцы экстрагировали буфером. После встряхивания и вращения в течение 5 минут в микроцентрифуге 2 мкл неочищенного экстракта наносили на нитроцеллюлозную мембрану и подвергали дот-блоттингу ELISA с использованием поликлональных козьих антител, специфичных для CryIA (b), по существу, как описано (10).Было обнаружено, что это антитело одинаково реагирует на CryIA (b) и CryIA (c). Уровни белка Bt измеряли из оцифрованных изображений блотов с использованием сканера, подключенного к настольному компьютеру с помощью программного обеспечения для анализа сигмагелей (Jandel, San Rafael, CA). Различные разведения очищенного с помощью быстрой жидкостной хроматографии, расщепленного трипсином белка CryIA (c) из B. thuringiensis subsp. kurstaki HD-73 наносили на каждый блот в качестве внутреннего стандарта с экстрактом из нетрансгенных растений в качестве отрицательного контроля.Определение белка выполняли с использованием реагентов для анализа белка Bio-Rad.

Блот-анализ ДНК и РНК.

Геномную ДНК (1–5 мкг) выделяли из тканей листа с помощью набора Easy-DNA (Invitrogen). Расщепленную ДНК фракционировали на 0,7% агарозном геле, переносили на нейлоновую мембрану и гибридизовали с зондами, меченными дигоксигенином (DIG), в соответствии с инструкциями производителя (Boehringer Mannheim). Тотальную РНК (10 мкг) экстрагировали из тканей листа методом горячего фенола (18).Транскрипты cryIA (b), и cryIA (c) анализировали стандартным методом Нозерн-блоттинга (19) с использованием DIG-меченных кодирующих последовательностей cryIA (b) и cryIA (c) в качестве зондов.

Тест потомства.

Самоопыленных семян (поколение R 1 ) трансформантов высевали в отвержденную среду Мурашиге и Скуга половинной концентрации с 50 мг / л гигромицина. Резистентность к гигромицину оценивали через 10 дней после посева.Для анализа белка GUS и Bt использовали ткани листьев, взятых у проростков, выращенных на той же среде с гигромицином или без него. Потомство, которое имело по крайней мере одно растение, показывающее экспрессию белка GUS или Bt , было зарегистрировано как положительное.

Биоанализы на насекомых.

Инсектицидная активность трансгенных растений в отношении двух основных рисовых насекомых SSB и YSB определялась с использованием лабораторных чашек для культивирования, аналогично описанным методам (6, 7).На стадии цветения стеблевые черенки с покровной тканью брали с растений R 1 трех первичных трансформантов. Растения были либо гомозиготными, либо гетерозиготными по генам Ubi-cryIA (b), или Ubi-cryIA (c) и были положительными по токсину Bt , как определено с помощью дот-блоттинга ELISA. Нетрансгенные растения, которые не содержали детектируемых токсинов Bt , отбирали из сегрегированных популяций и использовали в качестве отрицательного контроля. Масса яиц насекомых была собрана с рисовых полей в Международном научно-исследовательском институте риса на Филиппинах.Через один-пять дней после заражения сегменты стебля были разрезаны и исследованы на количество живых и мертвых насекомых, а также на повреждение тканей. Регистрировались только личинки, обнаруженные внутри стеблей.

РЕЗУЛЬТАТЫ

Преобразование риса.

Сводка экспериментов по трансформации представлена ​​в таблице 1. Эти данные показывают, что из 1 г инокулированного каллуса риса было получено 5–74 каллуса, устойчивых к гигромицину. Хотя значительная разница в урожайности устойчивых к гигромицину каллусов наблюдалась между разными штаммами риса и Agrobacterium tumefaciens , ее нельзя было объяснить только одним фактором, таким как генотип или A.tumefaciens комбинация штамм / плазмида. С другой стороны, из этих экспериментов ясно, что даже обычный штамм A. tumefaciens LBA4404 может производить устойчивый к гигромицину каллус с урожайностью, сравнимой с так называемым «супервирулентным» штаммом EHA105.

Всего было регенерировано 2603 растения из 533 линий каллуса девяти штаммов риса. Эти линии каллуса были отобраны из разных кусочков каллуса или хорошо разделенных областей одних и тех же каллусов и поэтому считались результатом независимых преобразований.Среди них 2026 растений были трансформированы из каллусов векторами, содержащими последовательность cryIA (b) , а остальные 577 растений были трансформированы последовательностью cryIA (c) . Из растений cryIA (b) 1661 растение трансформировали pKUB; 330 трансформировали pKBB, а остальные 35 растений трансформировали pKSB. В среднем регенерировали 3,9 растения на одну линию каллюса, перенесенную в среду для регенерации. Однако заметные различия в регенерирующей способности наблюдались не только между разными штаммами риса, но и между разными линиями каллусов одного и того же штамма.Например, 0–65 растений были регенерированы из различных линий каллуса в штамме риса 93VA, трансформированном EHA105 (pKUB). На основе линий каллюса в целом 79% из них могли регенерировать в растения, тогда как частота варьировала от 35 до 100% в различных вариантах обработки (Таблица 1). Для дальнейшей характеристики в теплице выращивали в общей сложности 892 устойчивых к гигромицину растений, представляющих весь рис, и комбинаций штаммов A. tumefaciens, . Эти растения состояли из 405 независимых трансформантов из 212 каллусов, сконструированных с Ubi-cryIA (b), , 93 с Ubi-cryIA (c), , 12 с 35S-cryIA (b) и 88 с Bp-cryIA (b) ) конструкции.

Интеграция Т-ДНК [часть плазмиды Ti (индуцирующей опухоль), которая переносится в клетки растений] в геном риса.

Чтобы установить трансгенную природу регенерированных растений, ДНК, экстрагированную из GUS-положительных растений R 0 пяти штаммов риса, расщепляли Bam HI и зондировали DIG-меченным gus. Bam HI разрезает только один раз внутри зондируемого трансгена (фиг. 1), непосредственно перед кодирующей последовательностью и, таким образом, обеспечивает важную информацию относительно положения вставки и номера трансгена.Из 16 проанализированных растений 12 имели только одну полосу гибридизации размером от 2,3 до> 10 т.п.н., тогда как остальные четыре растения имели от двух до трех полос (рис. 2 A ), что указывает на то, что проанализированные трансгенные растения имели от одной до трех полос. три вставки трансгена в разные места генома риса.

Рисунок 2

Саузерн-блот-анализ растений, регенерированных из каллусов, устойчивых к гигромицину. ДНК (1–5 мкг) переваривали соответствующими рестрикционными ферментами, разделяли на 0.7% агарозный гель и гибридизовали с меченным DIG зондом gus ( A ) или cryIA (b) ( B ). ( A ) ДНК, расщепленная Bam HI. Дорожки: 2–9 — растения, трансформированные pKUB; 10–11 — растения, трансформированные pKUC; 12–13 — растения, трансформированные pKSB; и 14-17, растения, трансформированные pKBB. ( B ) ДНК, расщепленная Hin dIII. Дорожки: 1, pKUB, расщепленный Hin dIII; 2 — нетрансформированное растение риса; 3–7, растения (сорт.93VA), трансформированный pKUC; 8–13 — растения (сорт Zhong8215), трансформированные pKUB; 14–16, растения (сорт T8340), трансформированные pKSB; и 17-19, растения (сорт Kaybonnet), трансформированные pKBB.

Для анализа целостности введенных генов ДНК из 107 растений R 0 , представляющих все штаммы риса, кроме Pin92–528 и T, была переварена с помощью Hin dIII, который высвободил Ubi-cryIA (b / c) гена. . Анализ проведен на 81 растении для cryIA (b) и 26 растений для cryIA (c) .Репрезентативный блот генов cry показан на фиг. 2 B . После переваривания Hin dIII полосы ДНК, соответствующие интактным химерным генам Ubi-cryIA (b) (4,1 т.п.н.), Ubi-cryIA (c) (4,1 т.п.н.), 35S- cryIA (b) (2,8 kb) и Bp10-cryIA (b) (2.6 kb) были обнаружены в 93% (75/81) из cryIA (b) растений и в 58% (15/26) из cryIA (c ) растений. Более того, диапазон гус на ожидаемой 1.Положение 8 т.п.н. наблюдалось у всех проанализированных растений. У большинства растений наблюдалась только одна полоса ожидаемого размера (данные не показаны). Это составило 68% из cryIA (b) — положительных растений, 80% из cryIA (c) -положительных растений и 92% из gus- положительных растений. В дополнение к этим ожидаемым полосам небольшая часть растений также давала сигналы гибридизации неожиданного размера, которые в основном были больше ожидаемого размера.

Экспрессия

cryIA (b) и cryIA (c) .

Продукция белков CryIA (b) и CryIA (c) в регенерированных растениях была исследована иммунологически с использованием поликлональных антител против CryIA (b), которые также оказались перекрестно реактивными с CryIA (c) (10). Когда белки были разделены электрофоретически на геле SDS, основная полоса, близко соответствующая очищенному токсину Bt , была обнаружена в растениях, трансформированных химерными генами cryIA (b) и (c) (рис. 3 A ). ).Также были замечены две-три быстро мигрирующих полосы. Было обнаружено, что эти дополнительные полосы являются результатом разложения белка в процессе кипячения при приготовлении образца (данные не показаны). В нетрансформированных растениях не было обнаружено реактивного белка с антителами.

Рисунок 3

Экспрессия cryIA (b), и cryIA (c) в Agrobacterium -трансформированных растениях риса. ( A ) Вестерн-анализ токсинов Bt в трансформированных растениях риса; 2–4 мкг белков, экстрагированных из нетрансформированных и трансформированных растений, подвергали 10% SDS / PAGE, переносили на нитроцеллюлозную мембрану и реагировали с поликлональными антителами, специфичными к CryIA (b).Образцы двух сортов Nipponbare (трансформированные pKUB, дорожки 1–7) и 93VA (трансформированные pKUC, дорожки 8–13) показаны на блоте вместе с CryIA (c) из B. thuringiensis в качестве стандарта. ( B ) Сравнение уровней cryIA (b), и cryIA (c) транскриптов и токсинов Bt . ( Панель A ) Нозерн-блоттинг транскриптов cryIA (b) и cryIA (c) растений, трансформированных pKUB (дорожки 2–7) и pKUC (дорожки 9–17).Полную РНК (10 мкг / дорожку) экстрагировали из тканей листа, разделяли электрофоретически на 1,2% агарозоформальдегидном геле, наносили блоттинг на нейлоновую мембрану Hybond-N и гибридизовали с меченным DIG cryIA (b) фрагментом. ( Панель B ) Соответствующие уровни токсина Bt в растениях, используемых для Нозерн-анализа. Уровни токсина Bt определяли путем сравнения интенсивности иммунологически развитой окраски образцов растений с окраской очищенного CryIA (c).

В поколении R 0 166 независимых трансформированных растений, содержащих Ubi-cryIA (b) , Ubi-cryIA (c) или 35S- cryIA (b) , были проанализированы на Bt белка, и 60% из них оказались положительными. Уровни сильно варьировались от простого предела обнаружения (0,1 нг / мкг белка) до> 30 нг / мкг (3%) растворимого белка в разных растениях. У большинства растений уровень токсина составлял от 0,2 до 2% растворимых белков.У 10 35S- cryIA (b) растений, определенных для их уровней белка Bt , они находились в диапазоне от 0 до 0,15% растворимого белка (пять растений = 0, одно растение <0,01, два растения = 0,04–0,05, два растения = 0,9–0,15% растворимого белка), что по крайней мере в 10 раз ниже уровней, наблюдаемых у большинства растений Ubi-cryIA (b) и Ubi-cryIA (c) . Как и ожидалось, специфический для пыльцы промотор гена Bp10 (13) не направлял детектируемую экспрессию CryIA (b) в ткани листа.

Нозерн-анализ 14 отобранных растений с различными уровнями токсина Bt показал, что в тканях листа присутствовали высокие уровни cryIA (b) и cryIA (c) транскриптов, а также положительная корреляция между уровнями транскриптов. и белки-токсины были очевидны (фиг. 3 B ).

Передача трансгенов половым путем.

Наследование трансгенов ( hph , cryIA (b) , cryIA (c) и gus ) исследовали в поколении R 1 от самоопыленных семян.Сегрегация по устойчивости к гигромицину наблюдалась в 18 потомках 19 первичных трансформантов, протестированных при выращивании проростков в среде, содержащей гигромицин (таблица 2). Коэффициенты сегрегации в 68% (13/19) протестированных линий соответствуют модели 3: 1 для наследования одного доминантного гена. В остальных шести линиях (32%) были более чувствительные растения, чем ожидалось по менделевской модели. Для исследования экспрессии связанных генов gus и Bt в растениях R 1 проростки 78 первичных трансформантов выращивали в среде, не содержащей гигромицина, и исследовали два трансгенных признака.Результаты, обобщенные в таблице 3, показали, что 94% (73/78) тестируемых линий выражали по меньшей мере один из двух трансгенных признаков в поколении R 0 . Из них 97% (71/73) смогли передать трансгенные признаки поколению R 1 , а оставшиеся 3% (2 линии) не смогли передать все трансгенные признаки, выраженные в поколении R 0 , на R 1 поколения. В большинстве потомков GUS + / Bt + косегрегация генов gus и Bt наблюдалась в проростках R 1 , то есть растения были положительными или отрицательными по обоим признакам.Однако несвязанная экспрессия gus и Bt также наблюдалась в нескольких потомках.

Таблица 2

Сегрегация устойчивости к гигромицину в R 1 поколение

Таблица 3

Передача трансгенных признаков в R 1 поколение

Инсектицидное действие.

Стеблевые черенки трех трансгенных линий, несущих Ubi-cryIA (b) (Zhong8215–4 и Kaybonnet-13) и Ubi-cryIA (c) (91RM-44), были заражены новорожденными личинками SSB и YSB.Через четыре и пять дней после заражения сегменты стебля были разрезаны и исследованы. Смертность 97–100% наблюдалась в трех трансгенных линиях для обоих насекомых (таблица 4), тогда как в контрольных тканях смертность в большинстве случаев составляла <5%. Очень немногие выжившие личинки на трансгенных сегментах стебля пострадали и вскоре погибли. Значительные повреждения тканей наблюдались у контрольных растений в результате питания SSB и YSB, тогда как в трансгенных тканях обнаруживались незначительные повреждения (рис.4 Aa и Ab ).

Таблица 4

Инсектицидная активность трансгенных растений риса к SSB и YSB

Рисунок 4

Инсектицидная активность трансгенного риса. ( A ) Повреждение тканей, вызванное кормлением SSB ( Aa ) и YSB ( Ab ). Стеблевые черенки контрольных (верхний) и трансгенных (К13) (нижний) растений заражали новорожденными личинками SSB или YSB и изображали через 5 дней после заражения. (× 5.) ( B ) Личиночное развитие SSB ( Ba ) и YSB ( Bb ) у нетрансгенных (верхних) и трансгенных (K13) (нижних) растений.Личинок SSB и YSB позволяли питаться стеблевыми черенками нетрансгенных и трансгенных растений, и их фотографировали через 1–4 дня после заражения. (× 10.)

Тщательное изучение показало, что личинки SSB и YSB, выращенные на трансгенных растениях, начали умирать через 1 и 2 дня после заражения, соответственно (рис. 5), и больше не росли после этого (рис. 4 Ba и Bb ). Через четыре и пять дней после заражения их смертность достигла 100% (рис. 5; таблица 4).Для сравнения, личинки SSB и YSB, питавшиеся контрольными растениями, имели очень низкую смертность (в среднем ≈5%; Рис. 4; Таблица 4) и нормально развивались, вызывая массивное повреждение тканей (Рис. 4), во время периодов биотестирования.

Рисунок 5

Ларвицидная активность трансгенных растений. Стеблевые черенки контрольных и трансгенных (K13) растений заражали новорожденными личинками YSB ( A ) или SSB ( B ). Смертность рассчитывалась через 1–5 дней после заражения.

ОБСУЖДЕНИЕ

На сегодняшний день Agrobacterium не использовалась для получения трансгенных растений риса с агрономически важными генами. A. tumefaciens использовался для получения трансгенных растений риса, в частности, с помощью «супербинарного» вектора, но эти растения несли только маркерные гены, а не полезные агрономические признаки (20-25).

В настоящем исследовании большое количество растений риса, несущих модифицированные гены инсектицидных белков Bt , cryIA (b), и cryIA (c) , были получены в девяти штаммах риса с использованием модифицированной процедуры трансформации Agrobacterium . .Этот результат дополнительно демонстрирует осуществимость и эффективность опосредованной Agrobacterium- трансформации риса. Более того, также ясно, что широко используемый штамм Agrobacterium (LBA4404) и производные бинарного вектора (Bin19) способны трансформировать рис с урожайностью, сравнимой с урожайностью супервирулентного штамма EHA105 (Таблица 1), несущего плазмиду, полученную из супервирулентного штамма EHA105 (Таблица 1). вирулентная Ti-плазмида pTiBo542 (26), что расширяет выбор Agrobacterium для трансформации однодольных.

Анализ

Саузерн-блоттинг с ДНК, расщепленной Bam HI, показал, что в большинстве проанализированных растений трансген был вставлен только один раз в геном риса, хотя в некоторых случаях могли иметь место две-три вставки (рис. 2 А ). Различные размеры сигналов гибридизации также указывают на то, что они являются результатом стабильной интеграции Т-ДНК в геном риса, а не эндофитного загрязнения Agrobacterium . Из 107 проанализированных растений R 0 все содержали по крайней мере один из трех исследованных генов [ cryIA (b), cryIA (c) и gus ].Этот результат указывает на то, что в использованной процедуре отбора практически не было ускользания (8). Отсутствие сигналов гибридизации по Саузерну для cryIA (b) и особенно cryIA (c) в небольшой пропорции gus гибридизационно-позитивных растений указывает на то, что не все перенесенные гены были вставлены в геном риса как интактные Т- Фрагменты ДНК. Однако наличие ожидаемых сигналов гибридизации у большинства трансформированных растений показало, что зондированные гены [ Ubi-cryIA (b) и Ubi-cryIA (c) ] и кодирующая последовательность gus остались нетронутыми при интеграции в геном риса (рис.2 В ).

Генетический анализ поколения R 1 на экспрессию трансгенов дополнительно продемонстрировал стабильное включение Т-ДНК в ядерную ДНК риса. Продукция токсина Bt передавалась половым путем потомству R 1 в большинстве тестируемых линий, наряду с устойчивостью к гигромицину и активностью GUS. Большинство сегрегационных паттернов наследования устойчивости к гигромицину было сформировано по менделевской манере (таблица 2).В небольшой части тестируемых линий отклонение от ожидаемых соотношений сегрегации могло быть результатом химерной структуры трансгенных растений. Высокая скорость косегрегации экспрессии генов токсина gus и Bt дополнительно подтвердила низкую степень реаранжировки ДНК, указанную с помощью анализа по Саузерну.

Был разработан ряд стратегий для увеличения экспрессии генов Bt . К ним относятся использование лидера малой субъединицы Arabidopsis thaliana и транзитного пептида для повышения эффективности транскрипции и трансляции (27), комбинация промотора 35S и интрона клещевины (4) и амплификация гена токсина в хлоропластах (28). ), а также изменение использования кодонов в соответствии с предпочтениями кодонов у растений (4–6, 10, 29, 30).В настоящем исследовании мы попытались достичь высокого уровня токсина Bt в рисе с помощью химерных генов, состоящих из синтетических и модифицированных кодирующих последовательностей Bt и сильного промотора убиквитина кукурузы, который, как было показано, направляет высокий уровень экспрессии репортерного гена у однодольных растений (31, 32). Хотя уровни токсина в 60% трансгенных растений с R 0 сильно различались между отдельными растениями с R 0 , они были иммунологически положительными в отношении CryIA (b) и CryIA (c).В ≈10% этих растений уровень токсинов достигал 3% от общего количества растворимых белков. Это в 10–100 раз превышает содержание CryIA (b) и CryIA (c) в ранее описанных трансгенных растениях риса (4–7). Это значительный прогресс, поскольку такие высокие уровни были предложены в качестве необходимого компонента эффективной комплексной программы борьбы с вредителями, ограничивающей рост устойчивости к насекомым трансгенных культур (33). Интересно отметить, что в предыдущем исследовании (6) с использованием промотора убиквитина кукурузы максимальный достигнутый уровень экспрессии составлял только 0.024% общего растворимого белка. Некоторые из причин дифференциальной производительности этого промотора могут включать методы переноса генов, количество копий гена, генотип хозяина, количество проверенных трансформантов и условия роста растений, которые, безусловно, заслуживают дальнейшего изучения.

Анализы кормления растений R 1 из трех независимых трансформантов подтвердили, что белки CryIA (b) и CryIA (c), продуцируемые в трансгенных растениях, были высокотоксичными для личинок SSB и YSB. Личинки начинали умирать через 1-2 дня после кормления трансгенными тканями стебля.Смертность ≈100% была достигнута через 4–5 дней после заражения. Уровни токсина в этих трансгенных растениях оценивались в 0,23–0,31% от общего количества растворимых белков во время кормления. Хотя в одном исследовании сообщалось, что значительно более низкое содержание CryIA (b) (0,009% растворимых белков) в трансгенном рисе обеспечивает 100% -ную смертность от YSB и SSB (5), гораздо более высокие уровни CryIA (b) и CryIA (c) ( до 0,05% и 0,024% растворимых белков) привели только к 10–50% и 76–92% смертности от SSB (4) и YSB (6).

В наших биопробах было замечено, что кормление SSB и YSB в первые 1-2 дня тканями трансгенного стебля было очень ограниченным и не вызывало значительного повреждения растений. Фактически, большинство личинок, особенно личинок YSB, были обнаружены мертвыми в ткани оболочки до того, как они смогли проникнуть в стебель. Взятые вместе, эти наблюдения предполагают, что уровни токсина у этих трансгенных животных достаточны, чтобы обеспечить высокую степень устойчивости к SSB и YSB у риса.Дальнейшее исследование взаимосвязи между уровнями токсинов и смертностью насекомых и, следовательно, устойчивостью насекомых, имеет большое значение для разработки подходящей стратегии борьбы с насекомыми для этой основной глобальной продовольственной культуры.

Благодарности

Мы посвящаем эту статью профессору Брайану С. Хартли, F.R.S., за его вдохновение и руководство. Доктор Т. Кандресс, Национальный институт исследований агрономического центра Бордо, 33883 Вилленав д’Орнон, Франция, предоставил плазмиду pKHG4; ДокторP.H. Quail, Центр экспрессии генов растений, Министерство сельского хозяйства США, Беркли, Калифорния, предоставил промотор убиквитина ; Доктор Э. Э. Худ, Pioneer Hi-Bred International, Де-Мойн, Айова, предоставил штамма A. tumefaciens EHA105; SmithKline Beecham Pharmaceuticals, Уортинг, Великобритания, пожертвовала динатрий тикарциллина; Программы селекции риса, Чжэцзянский сельскохозяйственный университет, Ханчжоу, Китай, и доктор К.А.К. Молденхауэр, Центр исследований риса Университета Арканзаса, Штутгарт, АР, любезно предоставили семена риса.Мы благодарны: доктору Н. Б. Кароцци, Ciba-Geigy, Research Triangle Park, NC, за антитело; Доктора К. Накамура, Университет Нагоя, Нагоя, Япония, и Т. Комари, Джапан Тобакко, Тойода, Япония, за советом; Доктор М. Коэн, Международный научно-исследовательский институт риса, Лос-Баньос, Филиппины, для яиц SSB и YSB и рекомендаций по биологическому анализу насекомых. Техническую помощь экспертов оказали К. Саудер, Д. Боунесс, Л. Фатерс и К. Данг. Работа поддержана Фондом Рокфеллера и Советом по естественным и инженерным исследованиям.Грант Международного фонда науки (C / 1345–2), стипендия Фонда Рокфеллера для получения докторской степени и стипендия Организации Объединенных Наций по вопросам образования, науки и культуры X.C. очень ценятся.

Сноски

  • ↵ ‡ Кому запросы на переиздание следует направлять по адресу: Департамент биохимии медицинского факультета Оттавского университета, 40 Marie Curie Private, Оттава, Онтарио, K1N 6N5 Canada.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *